Re: 간헐적 단식, re-feeding.. 페이어 패치 면역계 반응 탐구 cell...

[문형철]

문치연이 주목하는 fasting(금식)의 핵심 효과

1. autophagy

2. metabolic reprograming 

세포의 energy sensing 기능 정상화 --> 특히 면역세포 정상화...

영양 상태(특히 일시적 금식)가
장관 관련 림프 조직(Peyer's patches, PP) 의 면역세포 동태와
점막 면역 기능(특히 IgA 반응, 경구 내성)에 어떤 영향을 미치는가?

단순히 "영양 부족 = 면역 저하"가 아니라,
금식 자체가 적극적인 면역 재배치 프로그램을 유도한다는 점을 밝힘.

주요 실험 모델과 방법 

• 모델: 주로 6주령 BALB/c 수컷 마우스 (젊은 개체), 일부 무균 마우스·노령 마우스 대조
• 금식 프로토콜: 36시간 물만 섭취 → CE-2 사료로 재급식 (최대 72시간 추적)
• 핵심 기술
  • 세포 분석 (다색 패널): GC B (CD95+GL7+), naive B (IgM+IgD+), IgA+ B, Ki67, TUNEL/cleaved caspase-3 등
  • 세포 이동 추적: adoptive transfer (CellTrace Violet), KikGR 광변환 마우스 (PP에서 naive B 세포를 빨간색으로 표시 → BM 이동 확인)
  • 분자 수준: qPCR (Cxcl13, Cxcl12), Bio-Plex (p-Akt, p-mTOR, p-S6K), TEM (아포토시스 형태학), in vitro stromal cell (BLS12) glycolysis 조작 (2-DG, glucose starvation)
  • 기능적 평가: OVA+CT 경구 면역 → 항원 특이적 IgA ELISA, OVA 유발 설사 모델, 경구 내성 (DTH 억제 실험)

핵심 결과 (Figure 중심으로 정리)

1. 금식 시 PP 림프구 급감 (~50%)
   • GC B 세포와 IgA+ class-switched B 세포가 아포토시스로 대량 소실 (TUNEL, cleaved caspase-3, TEM)
   • naive B 세포는 PP에서 빠져나가 골수(BM) 로 대량 이동 (4배 이상 증가)
2. 이동 메커니즘
   • 금식 → PP stromal cell의 CXCL13 발현 급감 → naive B 세포가 PP에 붙잡히지 못하고 빠져나감
   • BM에서는 CXCL13이 오히려 증가 → naive B 세포가 BM으로 homing
   • 이 과정은 mTOR 억제 (rapamycin으로 재현 가능)와 밀접
   • stromal cell의 CXCL13 발현은 aerobic glycolysis에 의존 (Glut1↑, 2-DG·glucose starvation으로 CXCL13↓)
3. 재급식 시 복구
   • 영양 신호 → mTOR 재활성화 → stromal cell glycolysis 회복 → CXCL13 급상승 → naive B 세포가 BM에서 다시 PP로 귀환
   • 24–48시간 내에 PP 림프구 수 정상화
4. 기능적 결과 – 매우 중요
   • 반복 금식 → 항원 특이적 IgA 반응 현저히 저하 (OVA+CT, Salmonella-ToxC 모델)
   • 경구 내성 손상 → food antigen에 대한 과민 반응 증가
   • 음식 알레르기성 설사 악화 (OVA 알레르기 모델에서 diarrhea score↑, IgA↓)

생물학적 의의 & 함의 (graduate 수준 discussion 포인트)

• 금식은 단순한 "면역 억제"가 아니라 적응적 재배치 프로그램이다.
  • GC B / memory/effector B → 아포토시스 (에너지 절약)
  • naive B → BM으로 후퇴 (보호 및 예비 저장)
  • 재급식 시 빠른 재동원 → 점막 면역 빠른 복구
• immunometabolism의 새로운 연결고리 제시 stromal cell의 glycolysis → CXCL13 → B cell trafficking
• 임상적 시사점
  • 영양실조 / 간헐적 단식 시 점막 면역 취약성 증가 가능성 (IgA↓ → 장 감염·알레르기 위험↑)
  • 백신 접종 시 급식 타이밍이 중요할 수 있음 (급식 후 바로 접종 → IgA 반응 약화 가능)
  • 반대로, 비만·대사증후군에서 간헐적 단식이 점막 염증을 완화할 가능성도 (하지만 논문은 주로 부정적 측면 강조)

한계점 (논문에서 직접 언급하거나 추론 가능한 부분)

• 주로 juvenile (6주령) 마우스 → 성체/노령에서 정도가 약함 (Fig. S4)
• 사람 데이터 없음 → 인간 점막 면역에서의 보수성 미지수
• mTORC1 vs mTORC2 구분 부족 (rapamycin은 둘 다 억제)
• 장기적/만성 금식 효과 미탐색

대학원 세미나에서 다룰 때 자주 나오는 질문들:

• 왜 GC B 세포는 특히 취약한가? (고에너지 요구, 대사 취약성?)
• BM으로의 naive B 이동은 정말 "보호"인가, 아니면 다른 기능이 있는가?
• 인간에서 16:8 간헐단식 시 IgA 분비가 실제로 줄어드는가?

전체 메시지 (Figure 1의 핵심 발견)

• 금식 → PP 크기 급감 + B 세포 아포토시스 대량 유발 → 특히 germinal center (GC) B 세포가 주 타겟
• 재급식 → 빠른 회복 (크기·조직 구조 정상화, 아포토시스 거의 사라짐)

패널별 요약

• A: H&E 염색 (조직 전체 구조) Ad libitum (평상시 먹이 무제한) → 정상 크기 PP Fasting (36h) → PP 크기 현저히 축소 (거의 반으로 보임) Refeeding (48h) → 크기 거의 완전 회복 → 금식 시 림프구 수가 ~50% 감소한다는 정량 데이터와 일치 (논문 전체 결과)
• B: 면역형광염색 (B220⁺ B 세포 영역, CD3ε⁺ T 세포 영역, DAPI 핵) B 세포 follicle과 T 세포 영역의 기본 미세구조(microarchitecture)는 유지됨 → 금식 중에도 PP의 공간적 조직(구조)은 붕괴되지 않고, 단순히 세포 수가 줄어든다는 점 강조
• C: TUNEL assay (아포토시스 검출) + 정량 그래프 Fasting에서 TUNEL⁺ 세포 (아포토시스 세포)가 극적으로 증가 (약 7–8% 수준) Ad libitum과 refeeding에서는 매우 낮음 (~1–2%) → 통계적으로 매우 유의미 (p < 0.01) → 아포토시스가 주로 B 세포 follicle (특히 GC 영역)에서 발생
• D: cleaved caspase-3 염색 (아포토시스 effector caspase 활성화) Fasting에서 cleaved caspase-3⁺ 세포가 follicle 내 (특히 GC-like 영역)에 집중 → caspase-3 경로를 통한 programmed cell death 확인
• E: TEM (투과전자현미경, 초미세구조) Fasting: 핵 chromatin condensation, fragmentation 등 전형적 아포토시스 형태 다수 관찰 (x5000) Refeeding & Ad libitum: 정상 세포 모습 → phagocyte가 apoptotic body를 engulf하는 장면도 보임 (x1500) → 세포 수준에서 아포토시스가 실제로 일어나고, 청소(engulfment)까지 진행된다는 증거

Figure 1이 논문에서 차지하는 위치와 의의

• 논문의 첫 번째 주요 figure로서 "금식 시 PP에서 무슨 일이 일어나는가?"의 phenotypic 증거를 제시
• 단순히 세포 수가 줄었다는 게 아니라 → 대부분 GC B 세포와 class-switched B 세포(IgA⁺ 등)가 아포토시스로 소실
• naive B 세포는 PP에서 빠져나가 bone marrow로 이동 (이후 figure에서 증명)
• 재급식 시 stromal cell의 CXCL13 재발현 → naive B 세포 귀환 → 빠른 기능 회복 가능 → 이 adaptive response가 영양 상태에 따른 면역 재배치 프로그램의 시작점

금식은
PP에서 effector/memory B 세포를 적극적으로 제거(아포토시스)하고,
naive B 세포를 BM으로 후퇴시켜 에너지를 절약하는 동시에
재급식 시 빠른 재건을 준비하는 전략적 반응임을
Figure 1이 조직학적으로 강력히 뒷받침

이 그림은 반복적인 금식-재급식이 경구 감염 모델(recombinant Salmonella Typhimurium expressing tetanus toxoid fragment C, 줄여서 rSalmonella-ToxC 또는 Salmonella-ToxC)에서 유도되는 점막 면역 반응(특히 TT-specific IgA 분비)에 미치는 부정적 영향을 보여주는 핵심 증거입니다.

전체 메시지 (Figure S7의 핵심 발견)

• 반복 금식 (36시간 금식 + 재급식 패턴 반복)은 항원 특이적 IgA 반응을 현저히 약화시킨다. → Salmonella 감염을 통한 mucosal immunization에서 TT-specific fecal IgA 수준이 ad libitum (평상시 먹이) 그룹에 비해 유의미하게 낮아짐. → 이는 금식 시 Peyer's patches (PP)에서 GC B 세포/IgA+ B 세포가 아포토시스 되고, naive B 세포가 bone marrow로 후퇴하는 메커니즘과 직접 연결되어 점막 면역 기능 저하를 초래한다는 기능적 증거.

패널별 요약

• A: 실험 프로토콜 다이어그램 (Experimental Timeline)
  • Ad libitum 그룹: 정상 사료 무제한 섭취. Day 4에 Salmonella-ToxC 경구 감염 (5 × 10⁷ CFU).
  • Fasting 그룹: Day 0에 36시간 금식 → 재급식 → Day 4에 Salmonella 감염. 이후 반복 금식 (Day 17과 Day 31에 각각 36시간 금식).
  • 전체 관찰 기간: Day 0 ~ Day 38 (fecal 샘플 채취 시점: Day 0, 17, 21, 25, 31, 35, 38 등). → 금식은 감염 직전뿐만 아니라 감염 후에도 반복적으로 적용되어 장기적 영향을 평가. → Salmonella-ToxC는 tetanus toxoid fragment C (TT)를 발현하는 recombinant 균주로, TT를 모델 항원으로 사용해 IgA 반응을 측정 (참조: Hase et al., 2009; VanCott et al., 1996).
• B: TT-specific IgA in feces (ELISA 측정, OD₄₅₀ 값)
  • y축:粪便中 TT-specific IgA의 absorbance (OD₄₅₀).
  • x축: Day (0 → 38일).
  • Ad libitum 그룹 (검은 점, n=8): 감염 후 Day 17부터 IgA 급상승 → Day 21~35에서 peak (~0.6 수준) 유지 → 안정적 반응.
  • Fasting 그룹 (파란 점, n=7): 상승 속도 느림, peak 수준 낮음 (~0.4 이하).
  • 전체 곡선 비교: two-way ANOVA로 유의미한 차이 (p = 0.036). → 반복 금식 시 항원 특이적 IgA 분비가 현저히 감소 (attenuated generation of antigen-specific IgA). → 이는 PP에서의 B 세포 동역학 변화 (GC B apoptosis, naive B BM 이동)가 실제로 기능적 결과 (mucosal protection 저하)로 이어진다는 증거.

Figure S7이 논문에서 차지하는 위치와 의의

• Main Figure 6 (OVA+CT 경구 면역 모델)에서 반복 금식이 antigen-specific IgA↓, oral tolerance 손상, food allergy-like diarrhea 악화를 보였듯이, 이 보충 그림은 pathogen infection 모델(Salmonella)에서도 동일한 패턴을 재현 → 결과의 일반성(generalizability) 강화.
• 임상적 함의:
  • 영양 불균형/간헐적 단식/영양실조 상태에서 장내 병원체 감염 시 점막 IgA-mediated defense가 약화될 수 있음.
  • 백신 개발 시 (특히 경구 백신) 영양 상태/타이밍 고려 필요.
  • 반대로, 과도한 면역 반응 억제 목적(예: IBD)에서 금식 활용 가능성도 시사하지만, 논문은 주로 취약성 증가 측면 강조.

한마디로:
반복적인 36시간 금식-재급식은
Salmonella 경구 감염 모델에서
TT-specific fecal IgA 반응을 유의미하게 억제(p=0.036)하며,
이는 금식 유발 PP 면역세포 소실이 실제 점막 면역 기능 저하로 이어진다는 강력한 기능적 증거

ArticleVolume 178, Issue 5p1072-1087.e14August 22, 2019Open Archive

Download Full Issue

Fasting-Refeeding Impacts Immune Cell Dynamics and Mucosal Immune Responses

Motoyoshi Nagai1,2 ∙ Ryotaro Noguchi1,2 ∙ Daisuke Takahashi1 ∙ … ∙ Keiyo Takubo3 ∙ Taeko Dohi1,2 ∙ Koji Hase1,10,11 hase-kj@pha.keio.ac.jp … Show more

Affiliations & Notes

1Division of Biochemistry, Faculty of Pharmacy and Graduate School of Pharmaceutical Science, Keio University, Tokyo 105-8512, Japan

2Department of Gastroenterology, Research Center for Hepatitis and Immunology, Research Institute, National Center for Global Health and Medicine, Chiba 272-8516, Japan

3Department of Stem Cell Biology, Research Institute, National Center for Global Health and Medicine, Tokyo 162-8655, Japan

Publication History:

Received December 5, 2018; Revised April 30, 2019; Accepted July 25, 2019

DOI: 10.1016/j.cell.2019.07.047 External LinkAlso available on ScienceDirect External Link

Copyright: © 2019 Elsevier Inc.

User License: Elsevier user license | Elsevier's open access license policy

Published: August 22, 2019

• Download PDF
• Cite
•  
• Set Alert
• Get Rights
• Reprints

Download Full Issue

Previous articleNext article

Show Outline

Highlights

•

Fasting drastically reduces lymphocyte levels in Payer’s patches

•

Naive B cells migrate to bone marrow during fasting and then back upon refeeding

•

Nutritional signals are essential to maintain CXCL13 expression‎ by stromal cells

•

Fasting causes GC B cell death and attenuates antigen-specific IgA response

Summary

Nutritional status potentially influences immune responses; however, how nutritional signals regulate cellular dynamics and functionality remains obscure. Herein, we report that temporary fasting drastically reduces the number of lymphocytes by ∼50% in Peyer’s patches (PPs), the inductive site of the gut immune response. Subsequent refeeding seemingly restored the number of lymphocytes, but whose cellular composition was conspicuously altered. A large portion of germinal center and IgA+ B cells were lost via apoptosis during fasting. Meanwhile, naive B cells migrated from PPs to the bone marrow during fasting and then back to PPs during refeeding when stromal cells sensed nutritional signals and upregulated CXCL13 expression‎ to recruit naive B cells. Furthermore, temporal fasting before oral immunization with ovalbumin abolished the induction of antigen-specific IgA, failed to induce oral tolerance, and eventually exacerbated food antigen-induced diarrhea. Thus, nutritional signals are critical in maintaining gut immune homeostasis.

• 금식은 Peyer's patches 내 림프구 수를 급격히 감소시킨다.
• Naive B 세포는 금식 중 골수로 이동하며, 재급식 시 다시 Peyer's patches로 귀환한다.
• 영양 신호는 stromal cell의 CXCL13 발현을 유지하는 데 필수적이다.
• 금식은 germinal center B 세포 사멸을 유발하며, 항원 특이적 IgA 반응을 약화시킨다.

Summary 

영양 상태는

면역 반응에 잠재적으로 영향을 미칠 수 있으나,

영양 신호가 세포 동역학과 기능성을 어떻게 조절하는지는 여전히 불분명하다.

여기서 우리는

일시적 금식이 장 면역 반응의 유도 부위인 Peyer's patches (PPs) 내 림프구 수를

약 50% 급격히 감소시킨다는 것을 보고한다.

이어지는 재급식은

림프구 수를 겉으로는 회복시키는 듯 보이지만,

세포 구성은 현저히 변화되어 있었다.

금식 중에는

germinal center B 세포와 IgA⁺ B 세포의 상당 부분이 아포토시스를 통해 소실되었다.

한편, naive B 세포는

금식 동안 PP에서 골수로 이동하였으며,

재급식 시 stromal cell이 영양 신호를 감지하여

CXCL13 발현을 상향 조절함으로써 naive B 세포를 다시 PP로 모집하였다.

또한,

ovalbumin 경구 면역화 직전의 일시적 금식은

항원 특이적 IgA 유도를 완전히 차단하였고,

경구 내성 유도를 실패하게 하여

결국 식품 항원 유발 설사를 악화시켰다.

따라서

영양 신호는 장 면역 항상성을 유지하는 데 결정적이다.

Graphical Abstract

Keywords

1. Immunometabolism
2. Peyer's patch
3. bone marrow
4. B cell
5. CXCL13
6. mucosal immunity
7. nutritional signals
8. fasting
9. stroma cell
10. mTOR signaling
11. IgA

Introduction

Inappropriate calorie intake is a global health problem. In developing countries, the nutritional deficiency often compromises vaccination efficacy and increases the risk of infectious diseases (Kaufman et al., 2011; Savy et al., 2009; Scrimshaw and SanGiovanni, 1997). Furthermore, childhood malnutrition is a predisposing factor for environmental enteropathy characterized by intestinal dysfunction, increased intestinal permeability, and microbial dysbiosis (Brown et al., 2015; Humphrey, 2009). In industrialized countries, on the other hand, excessive food intake accompanied by a lack of exercise has augmented the incidence of obesity (World Health Organization, 2016), which is a significant risk factor for cardiovascular disease, metabolic syndromes, and cancer (Basen-Engquist and Chang, 2011; Grundy, 2004; Poirier et al., 2006). Low-grade inflammation due to obesity is significantly implicated in the development of these diseases (Visscher and Seidell, 2001). These observations indicate that nutritional status has a significant impact on the immune system.

The gastrointestinal mucosa is directly exposed to exogenous food ingredients and thus inevitably faces drastic changes in the nutritional status of the lumen during food uptake and fasting. We previously demonstrated that intestinal tissue is highly susceptible to deprivation of luminal nutrients, as temporal fasting arrested epithelial cell proliferation while refeeding induced hyperproliferation in the intestinal epithelium (Okada et al., 2013). Given that epithelial cell turnover constitutes a robust first-line barrier to external antigens, mucosal barrier function may be more vulnerable during fasting than during feeding. Considering that fasting relieves the burden of food-borne antigens and microorganisms on the gut mucosa, it is thus reasonable to decelerate epithelial cell turnover temporarily to minimize energy expenditure under nutrient deprivation.

The gut mucosal barrier consists of not only intestinal epithelium but also an underlying immune system that establishes the second-line barrier. The gut mucosal immune response is characterized by the production of dimeric or polymeric immunoglobulin A (IgA) to the mucosal surface (Lycke and Bemark, 2017). Secretory IgA (S-IgA) plays vital roles in host defense against pathogens, inhibition of microbial metabolite penetration, and regulation of the gut microbial community (Mantis et al., 2011; Uchimura et al., 2018; Wei et al., 2011). To efficiently induce S-IgA response, luminal antigens are actively taken to gut-associated lymphoid tissue, such as Peyer’s patches (PPs), that serve as an inductive site of mucosal immunity. In PPs, germinal center (GC) reactions, namely, class switch recombination to IgA as well as affinity maturation, occur continuously with the aid of follicular helper T (Tfh) cells. IgA class-switched B cells subsequently egress PPs and then home to the intestinal lamina propria via mesenteric lymph nodes (MLNs), the thoracic duct, and blood circulation, during which IgA+ B cells terminally differentiate into IgA-producing plasma cells.

Multiple lines of research have uncovered a link between immune cell function and metabolic status (Kau et al., 2011; Man and Kallies, 2015). For example, upon T cell receptor (TCR) stimulation, effector T (Teff) cells enhance the uptake and utilization of glucose to promote aerobic glycolysis. Activated Teff cells also upregulate glutaminolysis. Such metabolic reprogramming is essential for Teff cells to meet the energy demand of clonal expansion and effector functions, such as the production of inflammatory cytokines (Carr et al., 2010). Furthermore, IgA+ plasma cells in the intestine preferentially utilize glycolysis for energy metabolism, whereas naive B cells in PPs usually gain ATP through aerobic metabolism in mitochondria (Kunisawa et al., 2015). Stimulation with lipopolysaccharides (LPS) or B cell receptor (BCR) ligation upregulates glucose transporter 1 (Glut1) expression‎ in B cell activating factor (BAFF)-pretreated B cells, which eventually undergo metabolic reprogramming to glycolysis (Caro-Maldonado et al., 2014). Because B cell-specific Glut1 depletion leads to decreased B cell number and antibody production, glycolytic rewiring is critical for B cell activation. Upregulation of Glut1 expression‎ in activated B cells is primarily mediated by activation of the phosphatidylinositol 3-kinase (PI3K)-Akt pathway, which in turn enhances the mechanistic target of rapamycin (mTOR) signaling. Excessive activation of the PI3K-Akt-mTOR pathway increases the frequencies of Tfh cells and GC B cells in PPs, while the opposite is true, as disruption of mTORC1 or mTORC2 diminishes GC reactions and production of S-IgA (Zeng et al., 2016). Given that mTOR serves as a nutrient sensor, the whole-body nutritional status in response to energy intake and starvation may considerably affect the immune response. Indeed, fasting or fasting-mimic diet exerts a protective effect on bacterial sepsis and colitis by alleviating expression‎ of proinflammatory cytokines (Okada et al., 2017; Rangan et al., 2019), whereas glucose supplementation protects against influenza viral infection (Wang et al., 2016). However, the impact of nutritional signals on mucosal barriers, lymphocyte dynamics, and effector functions in the context of fasting and feeding remains unknown. Furthermore, most animal studies on calorie restriction and intermittent fasting have employed older mice, which may not adequately reflect biological responses during childhood and children susceptible to nutritional deficiency.

In the present study, we analyzed the influence of fasting-refeeding on cellular dynamics and functionality of the gut immune system mainly in juvenile mice. We observed that PP lymphocytes, particularly naive B cells, exhibit dynamic movement to the bone marrow (BM) during temporal fasting and then swiftly migrate back to PP in response to food intake. A similar oscillation of naive B cells based on the circadian rhythm was observed to a lesser extent in ad libitum-fed mice. Stromal CXCL13 expression‎ for recruiting and retaining B cell subsets was regulated by metabolic status depending on aerobic glycolysis. The frequency of memory-like B cell subsets markedly decreased after fasting-refeeding treatment, leading to attenuation of antigen-specific IgA production and oral tolerance to a food antigen, which eventually increased susceptibility to antigen-induced diarrhea.

서론 (Introduction)

부적절한 칼로리 섭취는

전 세계적인 건강 문제이다.

개발도상국에서는

영양 결핍이

백신 효능을 저하시키고

감염성 질환 위험을 증가시키는 경우가 많다

(Kaufman et al., 2011; Savy et al., 2009; Scrimshaw and SanGiovanni, 1997).

또한

아동기 영양실조는

장 기능 장애, 장 투과성 증가, 미생물 군집 불균형(dysbiosis)을 특징으로 하는

환경성 장병증(environmental enteropathy)의 소인 요인이다 (Brown et al., 2015; Humphrey, 2009).

반면

산업화된 국가에서는

운동 부족과 함께 과도한 식이 섭취로 인해 비만 발생률이 증가하였으며 (World Health Organization, 2016),

이는 심혈관 질환, 대사 증후군, 암의 주요 위험 인자이다

(Basen-Engquist and Chang, 2011; Grundy, 2004; Poirier et al., 2006).

비만으로 인한 저등급 염증은

이러한 질환 발병에 크게 관여한다 (Visscher and Seidell, 2001).

이러한 관찰 결과들은

영양 상태가 면역계에 상당한 영향을 미친다는 것을 시사한다.

위장 점막은

외부 식이 성분에 직접 노출되므로,

식사 섭취와 금식 동안 장내(lumen) 영양 상태의 급격한 변화를 필연적으로 겪는다.

우리는 이전에 장 조직이 장내 영양소 결핍에 매우 취약하다는 것을 입증하였는데,

일시적 금식은 상피세포 증식을 정지시키고

재급식은 장 상피에서 과증식을 유도하였다 (Okada et al., 2013).

상피세포 turnover가 외부 항원에 대한 강력한 1차 장벽을 구성한다는 점을 고려할 때,

점막 장벽 기능은

섭식 중보다 금식 중에 더 취약할 수 있다.

금식이

장 점막에 대한 식이 유래 항원과 미생물의 부담을 완화한다는 점을 감안하면,

영양소 결핍 상태에서 에너지 소비를 최소화하기 위해

상피세포 turnover를 일시적으로 늦추는 것은 합리적이다.

장 점막 장벽은

장 상피뿐만 아니라

그 아래에 위치한 면역계로 구성되며,

이는 2차 장벽을 형성한다.

장 점막 면역 반응은

점막 표면으로의 이합체 또는 다합체 면역글로불린 A (IgA) 생산을 특징으로 한다 (Lycke and Bemark, 2017).

분비 IgA (S-IgA)는

병원체에 대한 숙주 방어,

미생물 대사물 침투 억제,

장내 미생물 군집 조절 등에서 중요한 역할을 한다

(Mantis et al., 2011; Uchimura et al., 2018; Wei et al., 2011).

S-IgA 반응을 효율적으로 유도하기 위해 장내 항원은

Peyer's patches (PPs)와 같은 장 관련 림프 조직으로 적극적으로 운반되며,

이는 점막 면역의 유도 부위로 기능한다.

PPs에서는

follicular helper T (Tfh) 세포의 도움으로

IgA로의 class switch recombination 및 affinity maturation을 포함한

germinal center (GC) 반응이 지속적으로 일어난다.

IgA class-switched B 세포는

이후 PPs를 탈출하여

mesenteric lymph nodes (MLNs),

thoracic duct, 혈액 순환을 거쳐 장 lamina propria로 homing하며,

이 과정에서 IgA⁺ B 세포는 IgA 생산 plasma cell로 최종 분화한다.

다수의 연구에서

면역세포 기능과 대사 상태 간의 연관성이 밝혀졌다 (Kau et al., 2011; Man and Kallies, 2015).

예를 들어

T cell receptor (TCR) 자극 시 effector T (Teff) 세포는

glucose uptake와 이용을 증가시켜

aerobic glycolysis를 촉진한다.

활성화된 Teff 세포는

glutaminolysis도 상향 조절한다.

이러한 대사 재프로그래밍은

clonal expansion과 effector 기능(예: 염증성 사이토카인 생산)에 필요한

에너지 수요를 충족시키는 데 필수적이다 (Carr et al., 2010).

T 세포의 대사 재프로그래밍(metabolic reprogramming)이
T 세포의 발달·활성화·분화·기능에 핵심적이라는 내용.

T 세포는
상태(naive → effector → memory)에 따라
주로 사용하는 에너지 대사 경로가 바뀝니다.

1. T 세포 발달과 분화 과정에서의 대사 변화 (첫 번째 다이어그램)

• Naive T 세포 (성숙한 미활성화 T 세포): quiescent 상태 → 주로 OXPHOS (산화적 인산화, 미토콘드리아 호흡)와 약간의 FAO (지방산 산화)를 사용해 안정적인 ATP 생산.
• 흉선(thymus) 내 발달 (DN1 → DN4 → DP 단계): OXPHOS 중심.
• 활성화·프라이밍 (APC와 상호작용): 빠른 증식·효과기 기능 위해 glycolysis (해당과정, Warburg effect)로 전환.
• Effector T 세포 (Th1, Th2, Th17, CD8+ effector 등): glycolysis 강하게 의존 → 빠른 에너지 + 생합성 물질(뉴클레오타이드, 지질 등) 공급.
• Memory T 세포 (중앙 기억, effector memory): OXPHOS + FAO 중심 → 장기 생존·빠른 재활성화 준비.
• Treg (조절 T 세포): OXPHOS + FAO 선호 → 면역 억제 기능 유지.
• Tfh (여포 보조 T 세포): glycolysis 억제 경향 (Bcl6 등에 의해).

요약:
quiescent/장기 유지 세포 (naive, memory, Treg)
→ 산화 대사 (OXPHOS/FAO). 활성/효과기 세포 (effector Th1/Th2/Th17/CD8)
→ 해당 대사 (glycolysis).

2. 주요 대사 경로 연결 (두 번째 다이어그램)

• Glycolysis (해당과정): Glucose → Glucose-6-P → Pyruvate → Lactate (빠른 ATP + biosynthetic intermediates).
  • PPP (펜토스 인산 경로) → 뉴클레오타이드 합성.
  • Serine/glycine biosynthesis → 1-carbon unit (뉴클레오타이드 등).
• TCA cycle (크렙스 회로) + OXPHOS (전자전달계): Acetyl-CoA → citrate → α-KG → succinate 등 → ATP 대량 생산 + ROS.
• Glutaminolysis: Glutamine → α-KG → TCA cycle 보충 (anaplerosis).
• FAO (지방산 산화): Fatty acids → Acetyl-CoA → TCA/OXPHOS (memory/Treg에서 중요).
• FAS (지방산 합성): Acetyl-CoA → lipids (효과기 세포 증식 시 필요).

요약:

• Effector T 세포 → glycolysis ↑ + TCA 일부 + lactate 배출 (빠른 성장·기능).
• Memory/Treg → FAO + OXPHOS ↑ (효율적·장기 에너지).
• 모든 경로가 Acetyl-CoA와 TCA cycle로 연결되어 에너지·생합성 균형 유지.

T 세포는 “필요에 따라” 대사를 바꿔서:

• 빠른 싸움(효과기) → glycolysis 위주.
• 오래 버티기(기억·조절) → 미토콘드리아 중심 (OXPHOS + FAO).

이 대사 변화는 mTOR, HIF-1α, AMPK 등 신호에 의해 조절되며, 염증·암·자가면역 질환에서 중요한 타겟

또한

장 내 IgA⁺ plasma cell은

glycolysis를 에너지 대사로 우선적으로 이용하는 반면,

PPs 내 naive B 세포는 대개 mitochondria에서의 aerobic metabolism을 통해

ATP를 얻는다 (Kunisawa et al., 2015).

Lipopolysaccharides (LPS) 또는 B cell receptor (BCR) ligation 자극은

BAFF-pretreated B 세포에서

glucose transporter 1 (Glut1) 발현을 상향 조절하며,

이는 결국 glycolysis로의 대사 재프로그래밍을 유도한다 (Caro-Maldonado et al., 2014).

B 세포 특이적 Glut1 결핍은

B 세포 수와 항체 생산 감소를 초래하므로,

glycolytic rewiring은 B 세포 활성화에 중요하다.

활성화된 B 세포에서의 Glut1 상향은

주로 phosphatidylinositol 3-kinase (PI3K)-Akt 경로 활성화에 의해 매개되며,

이는 mechanistic target of rapamycin (mTOR) 신호를 강화한다.

PI3K-Akt-mTOR 경로의 과도한 활성화는

PPs 내 Tfh 세포와 GC B 세포 빈도를 증가시키는 반면,

mTORC1 또는 mTORC2의 disruption은

GC 반응과 S-IgA 생산을 감소시킨다 (Zeng et al., 2016).

mTOR가 영양 센서로 기능한다는 점을 고려할 때,

에너지 섭취와 기아에 따른 전신 영양 상태는 면역 반응에 상당한 영향을 미칠 수 있다.

실제로 금식 또는 fasting-mimic diet은

proinflammatory cytokine 발현 완화로

bacterial sepsis와 colitis에 보호 효과를 발휘하며 (Okada et al., 2017; Rangan et al., 2019),

glucose 보충은 influenza 바이러스 감염에 보호 효과를 준다 (Wang et al., 2016).

그러나

금식과 섭식 맥락에서 영양 신호가

점막 장벽, 림프구 동역학, effector 기능에 미치는 영향은 여전히 알려지지 않았다.

또한

칼로리 제한과 간헐적 금식에 대한 대부분의 동물 연구는 노령 마우스를 사용하였으며,

이는 영양 결핍에 취약한 아동기 생물학적 반응을 충분히 반영하지 못할 수 있다.

본 연구에서는

주로 juvenile 마우스(약 6주령)를 대상으로

fasting-refeeding이 장 면역계의 세포 동역학과 기능성에 미치는 영향을 분석하였다.

우리는 PP 림프구,

특히 naive B 세포가 일시적 금식 동안 bone marrow (BM)로 동적 이동하고,

음식 섭취에 반응하여 PP로 신속히 귀환한다는 것을 관찰하였다.

ad libitum-fed 마우스에서도

circadian rhythm에 기반한 naive B 세포의 유사한 oscillation이 관찰되었으나 정도가 덜하였다.

B 세포 subset을 모집하고 유지하는 stromal CXCL13 발현은

aerobic glycolysis에 의존하는 대사 상태에 따라 조절되었다.

fasting-refeeding 처리 후

memory-like B 세포 subset의 빈도가 현저히 감소하여

항원 특이적 IgA 생산과 식이 항원에 대한 경구 내성이 약화되었으며,

이는 결국 항원 유발 설사에 대한 취약성을 증가시켰다.

Results

Fasting Has a Profound Effect on the Morphology of PPs

To explore the impact of nutrient deficiency on the gut immune system, we maintained juvenile mice (around 6 weeks old) under fasting conditions for 36 h. The numbers of total cells, B cells, and T cells in PPs decreased by half after fasting compared with those of ad libitum-fed mice (Figure S1A). Such a drastic change was evident in PPs throughout the small intestine (Figure S1B). Immunofluorescent analysis demonstrated that the size of PPs was markedly reduced during fasting and was restored in response to refeeding. Despite this macroscopic alteration, the underlying microstructure composed of B cell follicles and T cell regions was not disturbed during fasting and refeeding (Figures 1A and 1B).

결과 (Results)

금식은

PPs의 형태에 심각한 영향을 미친다 (Fasting Has a Profound Effect on the Morphology of PPs)

영양소 결핍이 장 면역계에 미치는 영향을 탐색하기 위해,

juvenile 마우스(약 6주령)를 36시간 금식 조건에서 유지하였다.

금식 후 PPs 내 총 세포 수, B 세포 수, T 세포 수가

ad libitum-fed 마우스에 비해 절반으로 감소하였다 (Figure S1A).

이러한 급격한 변화는

소장 전반에 걸친 PPs에서 뚜렷하게 나타났다 (Figure S1B).

면역형광 분석 결과,

금식 동안 PPs 크기가 현저히 감소하였으며

재급식에 의해 회복되었다.

이러한 거시적 변화에도 불구하고,

B 세포 follicle과 T 세포 영역으로 구성된 미세구조는

금식과 재급식 동안 교란되지 않았다 (Figures 1A and 1B).

Figure 1 Characterization of PPs during Fasting and Refeeding

Show full captionFigure viewer

Figure S1 The Behavior of Lymphocytes in Multiple Organs during Fasting and Refeeding, Related to Figure 2

Show full captionFigure viewer

To explore the cause of decrease in the number of lymphocytes in PPs of fasted mice, we analyzed apoptotic cells and observed that fasting induced apoptosis in considerable number of B cell follicles, which were rescued by refeeding (Figure 1C). Apoptotic cells were mainly detected in the GC region as a light-blue zone by hematoxylin counterstaining (Figure 1D). Furthermore, transmission electron microscopy (TEM) showed a higher frequency of apoptotic cells characterized by nuclear chromatin condensation and fragmentation (Figure 1E, upper right) as well as phagocytes engulfing apoptotic bodies in the GC region during fasting (Figure 1E, lower right). Thus, a large portion of GC B cells, which include proliferating B cells and IgA class-switched B cells, were eliminated in PPs by cell death followed by phagocytosis in fasted mice.

Naive B Cells Circulate between PPs and BM in Response to Nutritional Status

Total cell number steeply declined with nutrient deprivation from 24 to 36 h and then gradually recovered by refeeding for an additional 72 h reflecting the histological observations (Figures 1A, 1B, and 2A). A similar tendency was observed for total B cells (Figure 2A); however, cell behavior was different among the B cell subpopulations. IgM+IgD+ naive B cells were restored to pre-fasting (healthy) levels within 72 h after refeeding, whereas CD95+GL7+ GC and IgA+ B cells failed to recover (Figure 2B). Consequently, PPs were predominantly filled with naive B cells after the mice experienced fasting and refeeding. Of note, total CD4+ and CD8+ T cells also decreased after 36 h of fasting and slowly increased with refeeding (Figure S1C), but because B cell subsets are deemed highly susceptible to food deprivation and intake, we focused on analyzing B cell dynamics.

총 세포 수가

영양 결핍(공복) 24~36시간 동안 급격히 감소한 후,

추가로 72시간 동안 재급식(refeeding)을 하면 점차 회복되는 양상을 보였으며,

이는 조직학적 관찰(Figures 1A, 1B, and 2A)과 일치한다.

총 B 세포에서도 유사한 경향이 관찰되었으나(Figure 2A),

B 세포 하위 집단(subpopulations)별로 세포 행동은 달랐다.

IgM⁺IgD⁺ naive B 세포는

재급식 후 72시간 이내에 공복 전(건강한) 수준으로 회복되었으나,

CD95⁺GL7⁺ germinal center(GC) B 세포와 IgA⁺ B 세포는 회복되지 못했다(Figure 2B).

결과적으로,

공복과 재급식을 경험한 쥐의 Peyer's patches(PPs)는

주로 naive B 세포로 채워졌다.

주목할 점은

총 CD4⁺ 및 CD8⁺ T 세포도 36시간 공복 후 감소하고

재급식 시 천천히 증가하였으나(Figure S1C),

B 세포 하위 집단이 음식 결핍과 섭취에 특히 민감하게 반응한다고 여겨지므로

우리는 B 세포 동역학(dynamics)에 초점을 맞춰 분석하였다.

Figure 2 Lymphocyte Dynamics in PPs and BM in Response to Fasting and Refeeding

Show full captionFigure viewer

GC B cells were eliminated by apoptosis and would be newly induced in response to food intake, which explains the delayed recovery during the refeeding period. On the other hand, the rapid recovery of naive B cells during the refeeding stage raises the possibility that this cell subset may migrate to effector sites (i.e., intestinal lamina propria) and/or extraintestinal lymphoid tissue during fasting and then gain re-entry to PPs during refeeding. To examine this possibility, we carefully analyzed cell dynamics in multiple tissues during fasting and refeeding. Fasting did not affect cell numbers of cecal patches (CPs), the MLNs, or the small intestine lamina propria (SILP) (Figure S1A). The number of splenic B cells, which mainly consisted of naive B cells, significantly decreased during fasting and then recovered after 48 h of refeeding (Figure S1D). In sharp contrast, total BM cell number increased during fasting and decreased after refeeding (Figure 2C). In particular, the naive B cell number expanded more than 4-fold during fasting and then steeply declined to basal levels by refeeding (Figures 2D and 2E). These dynamics of BM naive B cells were complementary to that of PP and splenic B cells (Figures 2B and S1D). The accumulation of BM naive B cells did not result from enhanced B cell generation because immature B (B220+IgM−IgD−) cells, as well as Ki67+ B cells, decreased during fasting. Hematopoietic stem/progenitor cells (HS/PCs) also decreased significantly during fasting and rapidly recovered in response to refeeding (Figures 2D, 2E, and S2A; Table S1). Moreover, the immunofluorescent analysis revealed that naive B cells were localized not only in the vascular region but also the BM cavity during fasting (Figures S2B and S2C). These data suggest that naive B cells most likely translocate to the BM during nutrient deprivation.

GC B 세포는

아포토시스(apoptosis)에 의해 제거되었으며,

음식 섭취에 대한 반응으로 새롭게 유도(induced)되기 때문에

재급식(refeeding) 기간 동안 회복이 지연되는 것으로 설명된다.

반면,

재급식 단계에서 naive B 세포가 빠르게 회복되는 것은

이 세포 하위 집단이 공복(fasting) 동안

효과기 부위(즉, 장 점막 고유층, intestinal lamina propria) 및/또는 장외 림프 조직(extraintestinal lymphoid tissue)으로

이동(migrate)한 후,

재급식 시 Peyer's patches(PPs)로 다시 들어올 가능성을 시사한다.

이 가능성을 검증하기 위해 우리는

공복과 재급식 동안 여러 조직에서의 세포 동역학(cell dynamics)을 면밀히 분석하였다.

공복은

맹장 패치(cecal patches, CPs),

장간막 림프절(MLNs), 또는

소장 점막 고유층(small intestine lamina propria, SILP)의 세포 수에 영향을 미치지 않았다(Figure S1A).

비장(spleen) B 세포 수(주로 naive B 세포로 구성됨)는

공복 동안 유의하게 감소하였고,

재급식 48시간 후에 회복되었다(Figure S1D).

이와 극명한 대조를 이루는 것은,

총 골수(bone marrow, BM) 세포 수가

공복 동안 증가하고 재급식 후 감소한 점이다(Figure 2C).

특히 naive B 세포 수는

공복 동안 4배 이상 팽창(expanded)한 후,

재급식 시 급격히 기저 수준(basal levels)으로 감소하였다(Figures 2D and 2E).

이러한 골수 naive B 세포의 동역학은

PP와 비장 B 세포의 동역학과 상보적(complementary)이었다(Figures 2B and S1D).

골수 naive B 세포의 축적(accumulation)은

B 세포 생성(generation)이 강화된 결과가 아니었다.

왜냐하면

미성숙 B 세포(immature B cells: B220⁺IgM⁻IgD⁻)와 Ki67⁺ B 세포(증식 중인 세포) 모두

공복 동안 감소하였기 때문이다.

조혈모세포/전구세포(hematopoietic stem/progenitor cells, HS/PCs) 역시

공복 동안 유의하게 감소하였고,

재급식에 빠르게 반응하여 회복되었다(Figures 2D, 2E, and S2A; Table S1).

또한,

면역형광 분석(immunofluorescent analysis)을 통해

공복 동안 naive B 세포가 혈관 영역(vascular region)뿐만 아니라

골수 cavity(BM cavity)에도 국재(localized)되어 있는 것이 확인되었다(Figures S2B and S2C).

이러한 데이터는

naive B 세포가 영양 결핍(nutrient deprivation) 동안

골수로 가장 가능성 높게 이동(translocate)한다는 것을 시사한다.

Figure S2 Flow Cytometry Gating Strategies and Localization of Naive B Cells in the BM, Related to Figure 2

Show full captionFigure viewer

To rigorously confirm‎ the bias of lymphocyte trafficking under fasting conditions, we adoptively transferred fluorescent dye-labeled PP cells from ad libitum-fed donors to either fasting or ad libitum-fed recipients (Figure 3A). After 18 h, the transferred lymphocytes preferentially migrated to the BM only when the recipient mice were fasted (Figure 3B). These BM-migrating cells were mainly naive B cells (Figure 3C). We also assessed lymphocyte trafficking with knock-in mice carrying Kikume-Green Red (KikGR) (Tomura et al., 2014). We selectively irradiated PPs with a 430-nm laser to induce photoconversion in PP lymphocytes before fasting (Figure 3D) and confirmed that PP naive B cells preferentially migrated to the BM, but not the spleen and MLN, during fasting (Figure 3E). Based on these observations, we considered that naive B cells might shuttle between the BM and PPs during the fasting and refeeding stages, respectively. Similar events were observed even under germ-free conditions (Figure S3), indicating that the gut microbiota is unlikely to contribute to the regulation of lymphocyte dynamics in response to fasting and refeeding. Notably, such B cell dynamics in response to food intake and deprivation was well conserved at all life stages (Figure S4).

Figure 3 Trafficking of Naive B Cells between PPs and the BM during Fasting

Show full captionFigure viewer

Figure S3 Minimal Contribution of Gut-Microbiota to the Behavior of Lymphocytes during Fasting, Related to Figure 2

Show full captionFigure viewer

Figure S4 The Behavior of Lymphocytes during Fasting and Refeeding in Aged Mice, Related to Figure 2

Show full captionFigure viewer

Circadian Oscillation in Lymphocyte Trafficking Was Observed in Ad Libitum-Fed Mice

The feeding behavior of mice is distinct between the daytime and nighttime. Because mice are nocturnal, they do not feed during the day. We observed slight body weight change of 25.0 ± 0.10 g and 23.6 ± 0.10 g at zeitgeber time 0 (ZT0) and ZT12, respectively, in 6-week-old BALB/c male mice; body weight was then restored by nighttime feeding. Therefore, we assumed that PP lymphocytes may exhibit circadian oscillation in response to nutritional status. Indeed, our time course analysis demonstrated that the number of PP naive B cells slightly decreased until ZT12. Conversely, in the BM, naive B cells increased with a peak value around ZT12 and then gradually declined at ZT16–24 (Figures 2F and 2G). Given that feeding behavior is minimal at ZT0–12 and active at ZT12–24 under physiological conditions, lymphocyte dynamics during daytime and nighttime were similar to those seen in the fasting-refeeding model, albeit to a lesser extent (Figures 2A–2E). We considered that food intake plays a central role in the circadian oscillations of naive B cells, and thus fasting disturbs the oscillation by retaining this lymphocyte population in the BM.

Nutritional Status Affects Chemokine Expression‎ in PP and BM

We further explored the molecular basis controlling lymphocyte dynamics in response to nutritional status. Chemokine-chemokine receptor interactions are critical in the regulation of immune cell trafficking. Among them, the CXCL13-CXCR5 axis is essential for the migration and retention of B cell subsets in lymphoid tissues including PPs (Ansel et al., 2000). We observed a significant decrease in Cxcl13 expression‎ in PPs during fasting, which was recovered by refeeding (Figure 4A). Interestingly, the opposite expression‎ pattern was observed in the BM. Although the CCL20-CCR6 axis is also indispensable for the maturation of B cell follicles in PPs (Varona et al., 2001), Ccl20 expression‎ remained stable during fasting (Figure 4B). These observations imply that differential CXCL13 expression‎ in PPs and BM at least partly account for the localization of naive B cells during fasting and refeeding.

Figure 4 Fasting Downregulates CXCL13 Expression‎ in PPs Independent of mTOR Signaling

Show full captionFigure viewer

The sphingosine 1-phosphate (S1P)-S1P receptor type 1 (S1P1) axis promotes egress of lymphocytes from peripheral lymphoid tissue into circulatory fluids under physiological conditions (Matloubian et al., 2004). However, treatment with FTY720 failed to prevent the fasting-dependent naive B cell trafficking from PPs to the BM (Figure S5), indicating that the S1P-S1P1 axis is likely not involved in regulating naive B cell dynamics in response to nutritional status.

Figure S5 Minimal Effects of FTY720 on B Cell Dynamics in PPs and the BM, Related to Figure 4

Show full captionFigure viewer

mTOR Signaling Partially Contributes to Lymphocyte Dynamics

To gain mechanistic insight into lymphocyte dynamics, we assessed the activation status of Akt-mTOR signaling, a sensor and integrator of external nutritional stimuli for regulating cellular metabolism and physiology, during fasting and refeeding. In the same experimental setting, we also treated the ad libitum-fed group with rapamycin, which mainly inhibits mTORC1 as well as mTORC2 to a lesser extent (Sarbassov et al., 2006), to determine mTOR signaling dependency. As anticipated, fasting suppressed phosphorylation of Akt-mTOR signaling molecules, such as p70 S6 kinase, Akt, IRS-1, and PTEN, in both PPs and BM (Figures 4C and S6). Phosphorylation of these molecules recovered to normal or even higher (e.g., p70 S6 kinase in PPs) levels after 24-h refeeding compared with that of the control ad libitum-fed group (Figure 4C).

Figure S6 Quantification of Phosphorylated Akt-mTOR Signaling Proteins in PPs and the BM, Related to Figure 4

Show full captionFigure viewer

Rapamycin treatment also decreased phosphorylation levels of most Akt-mTOR signaling molecules in PPs and the BM, except for Akt in PPs (Figures 4C and S6). Notably, rapamycin significantly reduced the number of all B cell subsets in PPs (Figure 4D). Consistent with previous studies (Limon and Fruman, 2012; Zeng et al., 2016), rapamycin markedly decreased GC B cell number by less than 20% of vehicle control (Figure 4D). In the BM, rapamycin treatment decreased the levels of immature B cells, but not naive B cells (Figure 4D). Meanwhile, rapamycin treatment did not alter expression‎ levels of chemokines, including Cxcl12 and Cxcl13, in PPs and the BM (Figure 4E). Thus, mTOR signaling may be critical for B cell survival but not for chemokine expression‎.

CXCL13 Production by Stromal Cells Requires Warburg-like Aerobic Glycolysis

To further dissect the role of nutrient signals in the regulation of chemokine expression‎, we focused on cellular metabolism. In juvenile mice, fasting drastically changed systemic nutritional status with hypoglycemia accompanied by elevated plasma β-hydroxybutyrate (BHB) levels (Figures 5A and 5B). We theorized that such nutritional changes may affect chemokine expression‎ in lymphoid tissue. To test this, we took advantage of the lymph node-derived stromal cell line BLS12, which abundantly produces CXCL13 upon stimulation with tumor necrosis factor-α (TNF-α) and anti-lymphotoxin-β receptor (LTβR) antagonistic antibodies (Katakai et al., 2008) (Figure 5C). We initially investigated the intracellular metabolic status of BLS12 cells by detecting Glut1 and MitoSOX expression‎, which represent functional markers for glycolysis and mitochondrial respiration, respectively (Kunisada et al., 2017). We found that exposure to TNF-α and anti-LTβR antibodies strongly skewed cellular metabolism toward glycolysis (Figure 5D). Correspondingly, glucose deprivation in activated BLS12 cells prominently decreased Cxcl13 expressions (Figure 5E). Further, inhibition of glycolysis by 2-deoxy-d-glucose (2DG) markedly downregulated Cxcl13 in activated BLS12 cells (Figure 5F) as well as in PP of mice fed ad libitum in association with decreases in B cell subsets (Figures 5G and 5H). On the other hand, neither BHB nor rapamycin influenced chemokine expression‎ in BLS12 cells (Figures 5I and 5J). These results indicate that metabolic reprogramming into Warburg-like aerobic glycolysis is a prerequisite for induction of CXCL13 in stromal cells.

Figure 5 Lymph Node-Derived Stromal Cells Depend on Glycolysis to Produce CXCL13

Show full captionFigure viewer

Repeated Fasting Attenuates Antigen-Specific IgA Response and Oral Tolerance Leading to Exacerbation of Food Antigen-Induced Diarrhea

Elimination of GC and IgA+ B cells from PPs during fasting increases the possibility of fasting-refeeding compromising immune responses against orally delivered antigens. To investigate this possibility, mice were orally immunized with ovalbumin (OVA) and cholera toxin (CT) as an adjuvant once a week, four times. In the fasting group, immunization was performed after 48 h of refeeding that followed 36-h fasting (Figure 6A); this regimen did not affect final body weight (Figure 6B). Oral immunization with OVA/CT gradually increased fecal OVA-specific IgA until day 32 in the ad libitum-fed control group; however, the OVA-specific IgA response was markedly attenuated in the fasting group (Figure 6C). Plasma OVA-specific IgA, IgM, and IgG were also significantly decreased in the fasting group (Figure 6D). Thus, fasted mice failed to gain the booster effect of repeated immunization. Considering that a subset of GC B cells differentiates into memory B cells, the elimination of GC B cells from PPs by fasting may have resulted in this abnormality. Similarly, fasting attenuated the generation of antigen-specific IgA in response to oral infection with a recombinant Salmonella strain expressing a tenuous toxoid fragment C (rSalmonella-ToxC) (Hase et al., 2009; VanCott et al., 1996) (Figure S7).

Figure 6 Repeated Fasting Suppresses Orally Induced Antigen-Specific Immune Responses

Show full captionFigure viewer

Figure S7 The Effect of Fasting on Salmonella-Induced Mucosal Responses, Related to Figure 6

Show full captionFigure viewer

Because antigen-specific IgA and IgG are considered a protective factor against allergic symptoms (Aghamohammadi et al., 2009; Strait et al., 2006; Yamaki et al., 2014), we explored the effect of repeated fasting on an OVA-induced diarrhea model (Figure 7A). We found that fasting promoted the development of diarrhea without significant increase of OVA-specific plasma IgE levels (Figures 7B and 7C), and repeated fasting diminished induction of plasma OVA-specific IgG and fecal OVA-specific IgA on day 14 and 20, respectively (Figures 7D and 7E). Total IgA in feces also significantly decreased in fasting group on day 14 (Figure 7E). These results suggest that impaired production of antigen-specific IgG and IgA, as well as total IgA, may have led to the exacerbation of diarrhea in the repeated fasting group.

Figure 7 Repeated Fasting Exacerbates Food Antigen-Induced Diarrhea

Show full captionFigure viewer

Furthermore, mice that were fasted before oral administration of OVA failed to induce oral tolerance to OVA, as evidenced by an increase in auricular swelling due to delayed-type hypersensitivity after subcutaneous challenge (Figures 7F and 7G). In line with this, suppression of systemic IgG response to the antigen injection by oral administration of OVA was not observed in the fasting mice, indicative of impaired systemic unresponsiveness (Figure 7H). Altogether, our findings indicate that exacerbation of diarrhea most likely resulted from disturbance in antigen-specific mucosal immune responses as well as tolerogenic responses, underscoring the essential role of nutrient signals in the maintenance of gut immune homeostasis by securing PP cellularity.

Discussion

Our findings demonstrated the dynamic behavior of lymphocytes during fasting and refeeding. Fasting decreased the number of PP lymphocytes while refeeding selectively restored naive—but not GC and IgA class-switched—B cells. GC B cells underwent massive apoptosis due to downregulation of mTORC1 signaling during fasting, whereas PP-derived naive B cells migrated into the BM in a CXCL13-dependent manner—at least in part. CXCL13 expression‎ by peripheral stromal cells was mostly dependent on glycolysis. Moreover, repeated fasting attenuated antigen-specific IgA response and oral tolerance, which eventually exacerbated antigen-induced diarrhea.

Under physiological conditions, a variety of food antigens accompanied by opportunistic pathogens are continuously delivered to the intestinal mucosa. The intestinal mucosa in adult humans possesses a total surface area of 200 m2. PPs conduct immunosurveillance on the mucosal surface to eliminate potentially hostile agents. A preconceived notion is that the gut mucosal immune system constitutively induces immune responses as evidenced by active GC reactions (Cesta, 2006). However, our findings revealed that immunological activity in PPs is nearly shut down during fasting where approximately half of lymphocytes egress PPs or undergo apoptotic cell death. B cells comprise a major population of PPs, where the B cell/T cell ratio is 5-fold higher than in peripheral lymph nodes (Abbas et al., 2014). We found that B cell populations were highly susceptible to food deprivation; however, the physiological significance of this phenomenon remains to be elucidated. Given that both luminal antigens and nutrient supply are greatly reduced during the fasting period, diminution of the lymphocyte pool may minimize energy expenditure. Despite hypoplastic morphology under fasting conditions, the fundamental microstructures of PPs remained intact and showed a rapid restoration in response to refeeding. Such plasticity based on dynamic B cell movement characterizes PPs as mucosa-associated lymphoid tissue. From another point of view, it is possible that the hypoplastic status is the default of PPs devoid of nutritional signals. Daily food intake most likely confers immunological activity to PPs by recruiting lymphocytes, mainly naive B cells.

The recirculation of naive B cells between PPs and the BM also occurred as circadian oscillation under physiological conditions. In mouse lymph nodes, noradrenalin-dependent β2-adrenergic stimuli at night upregulate CCR7 and CXCR4 on lymphocytes to suppress cell egress from lymph nodes (Suzuki et al., 2016). Accordingly, lymphocytes accumulate in the lymph node at night and circulate in the blood during the day due to decreased noradrenaline levels. It remains an open question whether this mechanism also contributes to the circadian oscillation of PP naive B cells. However, considering that fasting abrogated recirculation of naive B cells between PP and the BM, food intake should serve as a primary element in the regulation of PP naive B cell dynamics. Indeed, the naive B cell population rapidly expanded in response to refeeding; this rapid recovery cannot be explained by enhanced B cell generation, given that there are multiple steps of differentiation from HSCs into naive B cells, via pro-B, pre-B, immature B, and transitional B cell stages (Allman and Pillai, 2008; Shapiro-Shelef and Calame, 2005). Because naive B cells accumulate in the BM during fasting, we considered that the BM may function as a reservoir of naive B cells to rapidly release the cells to mucosa-associated lymphoid tissue in response to food intake. In support of this view, histological analysis of the BM of fasted mice detected an accumulation of naive B cells in the BM cavity, especially in the vicinity of blood vessels. Such a perivascular niche is also known as a site for HSC differentiation and proliferation (Oh and Nör, 2015), suggesting that this region can establish a microenvironment rich in cell survival factors (e.g., BAFF and growth factors) for naive B cells (Schweighoffer and Tybulewicz, 2018; Zhang et al., 2004).

The Akt-mTOR signaling pathway is known to converge various external signals, including growth factors, insulin, glucose, and amino acids (Laplante and Sabatini, 2012; Saxton and Sabatini, 2017). Induction of GC B cells largely depends on mTOR signaling (Ersching et al., 2017). Over-activation of PI3K-Akt-mTOR and inhibition of mTOR exert positive and negative effects on GC B in PPs, respectively (Zeng et al., 2016). Furthermore, B cell-specific deletion of Rictor, the core subunit of mTORC2, affects the survival and proliferation of B cells (Lee et al., 2013). Meanwhile, conditional deletion of a core mTORC1 protein in activated B cells arrests GC B cell differentiation, leading to a decrease in antigen-specific memory B cells and plasma cells (Raybuck et al., 2018). In agreement with these studies, we also observed that rapamycin treatment prominently reduced GC B cells in PPs. Because fasting mitigated mTOR activity in PPs, we consider that the massive cell death of GC B cells during fasting is attributed to the downregulation of mTORC1 signaling. Furthermore, GC B cells did not recover rapidly by refeeding and PPs were mainly replenished by naive B cells. Accordingly, the production of antigen-specific IgA in feces after repeated oral immunization with OVA and CT significantly decreased when mice were fasted before immunization. These results, together with previous observations, indicate that repeated fasting may eliminate antigen-specific memory B cells due to downregulation of mTOR signaling, which eventually attenuates the mucosal immune response.

The importance of CXCL13 for the development and maintenance of lymph nodes, including PPs, has been well documented (Ansel and Cyster, 2001; Ansel et al., 2000; Okada et al., 2002). This chemokine is mainly expressed by marginal reticular cells (MRCs) in lymphoid tissue (Katakai et al., 2008). Recent single-cell transcriptome analysis demonstrated that MRCs and follicular dendritic cells (FDCs) individually express CXCL13; however, the fact that MRCs outnumber FDCs implicates MRCs as a significant source of CXCL13 (Rodda et al., 2018). BLS12 cells, which we used in this study to dissect the molecular basis of CXCL13 production, share many characteristics with MRCs. For instance, BLS12 cells express several adherent molecules, including VCAM-1, ICAM-1, MAdCAM-1, and RANKL. These molecules are also highly upregulated in the MRC-like network of mucosa-associated lymphoid tissues, such as PPs, nasopharynx-associated lymphoid tissues, and CPs (Katakai et al., 2008). Furthermore, activation of protein kinase C and nuclear factor κB (NF-κB) pathways upon stimulation with TNF-α and anti-LTβR agonist antibodies mediates CXCL13 expression‎ in BLS12 cells (Katakai et al., 2008; Suto et al., 2009). We found that activated BLS12 cells undergo metabolic reprogramming to aerobic glycolysis, which is critical for the production of CXCL13. This metabolic shift from oxidative phosphorylation to aerobic glycolysis is well characterized in activated M1 macrophages and monocytes as well as Th1 and Th17 cells (Kelly and O’Neill, 2015; Michalek et al., 2011; O’Neill and Hardie, 2013). Unexpectedly, activation of mTOR signaling was found dispensable for metabolic reprogramming and CXCL13 production in MRCs, because rapamycin treatment failed to suppress both in in vitro and in vivo settings. Although rapamycin administration did not influence Akt phosphorylation in PPs, fasting markedly decreased phosphorylation levels. Akt senses nutrients and upregulates not only the mTOR pathway but also other signaling pathways. For instance, Akt signaling activates phosphofructokinase 2/fructose-2,6-bisphosphatase 2 (PFKFB2), a key regulator of glycolysis (Novellasdemunt et al., 2013; Sreedhar et al., 2017). Notably, inhibition of glycolysis by 2DG or glucose deprivation significantly downregulated Cxcl13 expression‎. Therefore, we speculate that CXCL13 expression‎ by MRCs in PPs may be mediated by Akt signaling in an mTORC1-independent manner, although further investigation is required to test this hypothesis.

We also found that repeated fasting exacerbates food antigen-induced diarrhea in association with defects in antigen-specific IgA response and oral tolerance. In the gastrointestinal tract, dimeric IgA produced in the lamina propria is transported to the mucosal surface by the action of polymeric Ig receptors in intestinal epithelial cells (Corthésy, 2013; Pabst, 2012). Secretory IgA may prevent translocation of luminal antigens in the body, and antigen-specific monomeric IgA in the blood prevents anaphylaxis by competitively inhibiting the association of allergens with antigen-specific IgE on mast cells (Yamaki et al., 2014). Selective IgA deficiency (IGAD) is the most common primary antibody deficiency, where IGAD patients frequently develop allergic disorders, including asthma, atopic dermatitis, and food allergies (Aghamohammadi et al., 2009; Schaffer et al., 1991). Moreover, allergen-specific IgG protects against anaphylaxis and food allergy by neutralizing allergens and cross-linking to an inhibitory IgG receptor, FcγRIIB (Strait et al., 2006; Wagenaar et al., 2018). We consider that the exacerbation of diarrhea in fasting mice may be caused by the attenuated induction of antigen-specific IgA and IgG, together with insufficient oral tolerance. The mechanism underlying the abnormality in oral tolerance remains unknown. Early works have shown that PPs are essential for inducing oral tolerance to OVA (Fujihashi et al., 2001), although MLNs can also induce oral tolerance in the absence of PPs (Spahn et al., 2002). Several mechanisms have been proposed to account for oral tolerance, which includes clonal deletion or anergy of allergen-specific T cells and the induction of regulatory T (Treg) cells (Pabst and Mowat, 2012). Another study supports the central role of effector/memory-type Treg cells in the establishment of oral tolerance (Siewert et al., 2008). CD103+ dendritic cells drive the differentiation of Treg cells by secreting all-trans retinoic acid. Furthermore, dietary antigens are required to induce peripheral induction of Treg cells in the small intestine (Kim et al., 2016). Fasting may thus affect the frequency of antigen-specific Treg and/or CD103+ dendritic cells. Collectively, our findings demonstrate that nutritional stimuli are fundamental for maintaining gut immune homeostasis by facilitating antigen-specific IgA and oral tolerance.

Multiple studies have defined the beneficial effects of fasting or calorie restriction regarding metabolic diseases in overnutrition/obesity models. In these studies, time-restricted feeding, calorie restriction, fasting mimicking diets, and short/long-term fasting optimize nutritional balance to prevent or ameliorate multiple disorders, such as metabolic disorders, cardiovascular disease, and autoimmune disorders (Brandhorst et al., 2015; Hatori et al., 2012; Okada et al., 2017; Wei et al., 2017). In sharp contrast, a time-restricted feeding regimen in juvenile mice exacerbated metabolic disorders (Hu et al., 2019). This is analogous to our finding that repeated fasting in juvenile mice promoted food antigen-induced diarrhea. These observations suggest that fasting and time-restricted feeding during growth may cause detrimental effects depending on the feeding regimens and the age of test animals.

In conclusion, we found that food intake secures the integrity and function of the gut mucosal immune system through nutritional signaling. Nutritional deprivation impairs mucosal immunity, leading to immune barrier dysfunction and excessive allergic response. Our study uncovered a novel link between nutritional signals and immune cell dynamics and functionality. Furthermore, these findings may promote research and treatment courses for enhancing vaccine efficacy via dietary intervention.

STAR★MethodsKey Resources Table

REAGENT or RESOURCESOURCEIDENTIFIER

Antibodies
Anti-cleaved caspase-3 (Asp175) (polyclonal)	Cell Signaling Technology	Cat#9661; RRID: AB_2341188
Anti-rat IgG (H+L) TRITC (polyclonal)	Southern Biotech	Cat#3030-03; RRID: AB_619945
Anti-rat IgG (H+L) Alexa Fluor 633 (polyclonal)	Thermo Fisher Scientific	Cat#A21094; RRID: AB_2535749
Anti-mouse TER-119 PerCP-Cy5.5 (TER-119)	TONBO biosciences	Cat#65-5921; RRID: N/A
Anti-mouse Lymphotoxin beta R/TNFRSF3 (polyclonal)	R and D systems	Cat#AF1008; RRID: AB_354531
Anti-mouse Ly6A/E PE-Cy7 (Sca-1)	Biolegend	Cat#122514; RRID: AB_756199
Anti-mouse Ly-6G/Gr1 PerCP-Cy5.5 (RB6-8C5)	eBioscience	Cat#45-5931; RRID: AB_906247
Anti-mouse Ki-67 PE-Cy7 (SolA15)	eBioscience	Cat#25-5698; RRID: AB_11220070
Anti-mouse IgM PE (R6-60.2)	BD PharMingen	Cat#553409; RRID: AB_394845
Anti-mouse IgM PE dozzle 594 (RMM-1)	Biolegend	Cat#406529; RRID: AB_2566585
Anti-mouse IgM HRP (polyclonal)	Southern Biotech	Cat#1020-05; RRID: AB_619903
Anti-mouse IgM Alexa Fluor 488 (polyclonal)	Thermo Fisher Scientific	Cat#A21042; RRID: AB_2535711
Anti-mouse IgG HRP (polyclonal)	Southern Biotech	Cat#1030-05; RRID: AB_2619742
Anti-mouse IgD APC (11-26c.2a)	Biolegend	Cat#405713; RRID: AB_10645480
Anti-mouse IgA HRP (polyclonal)	Southern Biotech	Cat#1040-05; RRID: AB_2714213
Anti-mouse IgA FITC(C10-3)	BD PharMingen	Cat#559354; RRID: AB_397235
Anti-mouse GL7 Pacific Blue (GL7)	Biolegend	Cat#144614; RRID: AB_2563292
Anti-mouse Endomucin (V.7C7.1)	abcam	Cat#ab106100; RRID: AB_10859306
Anti-mouse CD95 FITC (Jo2)	BD PharMingen	Cat#554257; RRID: AB_395329
Anti-mouse CD8α PerCP-Cy5.5 (53-6.7)	TONBO biosciences	Cat#65-0081; RRID: AB_2621882
Anti-mouse CD48 FITC (HM48-1)	Biolegend	Cat#103404; RRID: AB_313019
Anti-mouse CD45R/B220 V450 (RA3-6B2)	BD Horizon	Cat#560472; RRID: AB_1645276
Anti-mouse CD45R/B220 PE (RA3-6B2)	eBioscience	Cat#12-0452; RRID: AB_465671
Anti-mouse CD45R/B220 FITC (RA3-6B2)	BD PharMingen	Cat#553088; RRID: AB_394618
Anti-mouse CD45R/B220 APC-eFluor 780 (RA3-6B2)	eBioscience	Cat#47-0452; RRID: AB_1518810
Anti-mouse CD45R/B220 APC (RA3-6B2)	eBioscience	Cat#17-0452; RRID: AB_469395
Anti-mouse CD45R/B220 (RA3-6B2)	eBioscience	Cat#14-0452; RRID: AB_467254
Anti-mouse CD45R/B220 PerCP-Cy5.5 (RA3-6B2)	TONBO biosciences	Cat#65-0452; RRID: AB_2621892
Anti-mouse CD45 BV510 (30-F11)	Biolegend	Cat#103137; RRID: AB_2561392
Anti-mouse CD44 PE-Cy7 (IM7)	eBioscience	Cat#25-0441; RRID: AB_469623
Anti-mouse CD4 PerCP-Cy5.5 (RM4-5)	TONBO biosciences	Cat#65-0042; RRID: AB_2621876
Anti-mouse CD4 APC-eFluor 780 (GK1.5)	eBioscience	Cat#47-0041; RRID: AB_11218896
Anti-mouse CD3ε V500 (500A2)	BD Horizon	Cat#560771; RRID: AB_1937314
Anti-mouse CD3ε BV605 (145-2C11)	Biolegend	Cat#100351; RRID: AB_2565842
Anti-mouse CD3ε APC (145-2C11)	TONBO biosciences	Cat#20-0031; RRID: AB_2621537
Anti-mouse CD3ε (145-2C11)	BD PharMingen	Cat#550275; RRID: AB_393572
Anti-mouse CD34 FITC (RAM34)	eBioscience	Cat#11-0341; RRID: AB_465020
Anti-mouse CD31 (MEC 13.3)	BD PharMingen	Cat#550274; RRID: AB_393571
Anti-mouse CD16/CD32 Alexa Fluor 700 (93)	eBioscience	Cat#56-0161; RRID: AB_493994
Anti-mouse CD16/CD32 (2.4G2)	TONBO biosciences	Cat#70-0161; RRID: AB_2621487
Anti-mouse CD150/SLAM PE (TC15-12F12.2)	Biolegend	Cat#115904; RRID: AB_313683
Anti-mouse CD135 APC (A2F10)	Biolegend	Cat#135310; RRID: AB_2107050
Anti-mouse CD127/IL-7Rα PE (SB/119)	Biolegend	Cat#121111; RRID: AB_493510
Anti-mouse CD11b PerC-/Cy5.5 (M1/70)	TONBO biosciences	Cat#65-0112; RRID: AB_2621885
Anti-mouse CD117/c-kit APC-Cy7 (2B8)	Biolegend	Cat#105826; RRID: AB_1626278
Anti-cleaved caspase-3 (Asp175) (polyclonal)	Cell Signaling technology	Cat#9661; RRID: AB_2341188
Anti-mouse GULT1 Alexa Fluor 647 (EPR3915)	abcam	Cat#ab195020; RRID: AB_2783877
Anti-hamster IgG (H+L) FITC (polyclonal)	Southern Biotech	Cat#6210-02; RRID:N/A
Bacterial and Virus Strains
rSalmonella–ToxC (ΔaroA, ΔaroD)	VanCott et al., 1996	N/A
Chemicals, Peptides, and Recombinant Proteins
Cholera toxin (CT)	List Biological Laboratories	Cat#100B
Tetanus toxoid (TT)	BIKEN foundation	N/A
Freund’s Adjuvant, Complete (CFA)	Sigma Aldrich	Cat#F5881
Imject Alum Adjuvant	Thermo Fisher Scientific	Cat#77161
Alubmin, Chicken Egg (Ovalbumin) Grade V (OVA)	Sigma Aldrich	Cat#A5503; CAS: 9006-59-1
Rapamycin	LC Laboratories	Cat#R-5000; CAS: 53123-88-9
Fingolimod (FTY720)	Cayman Chemical Company	Cat#10006292; CAS: 162359-56-0
2-Deoxy-D-glucose (2DG)	abcam	Cat#ab142242; CAS: 154-17-6
3-Hydroxybutyric acid/β-hydroxybutyrate (BHB)	Sigma Aldrich	Cat#166898; CAS: 300-85-6
Murine Tumor Necrosis Factor-α (TNF-α)	Peprotech	Cat#315-01A
7-Aminoactinomycin D (7-AAD)	TONBO	Cat#13-6993
Fixable Viability Dye eFluor 780	Thermo Fisher Scientific	Cat#65-0865
LIVE/DEAD Fixable Blue Dead Cell Stain Kit, for UV excitation	Thermo Fisher Scientific	Cat#L23105
SYTOX Blue Dead Cell Stain, for flow cytometry	Thermo Fisher Scientific	Cat#S34857
MitoSOX Red Mitochondrial Superoxide Indicator (MitoSOX-PE)	Thermo Fisher Scientific	Cat#M36008
CellTrace Cell Proliferation Kits CellTrace Violet (CellTrace Violet)	Thermo Fisher Scientific	Cat#C34557
Quetol 812	Nissin EM	Cat#340
Deoxyribonuclease I (DNase I)	Sigma Aldrich	Cat#DN25; CAS: 9003-98-9
Collagenase	Wako	Cat#032-22364; CAS: 9001-12-1
cOmplete, mini Protease Inhibitor Cocktail	Roche	Cat#04-693-124-001
TRIzol Reagent	Thermo Fisher Scientific	Cat#15596026
EagleTaq Universal Master Mix (ROX)	Roche	Cat#07-260-288-190
Power SYBR Green PCR Master Mix	Applied Biosystems	Cat#4367659
Critical Commercial Assays
Bio-Plex Pro Cell Signaling Akt Panel 8-Plex Assay	Bio Rad	Cat#LQ0-0006JK0K0RR
LEGEND MAX Mouse OVA Specific IgE ELISA Kit with Pre-coated Plates	Biolegend	Cat#439807
ELISA MAX Mouse Mouse IgE	Biolegend	Cat#432403
Mouse IgA ELISA Quantitation Set	Bethyl Laboratories	Cat#E90-103
Mouse IgG ELISA Quantitation Set	Bethyl Laboratories	Cat#E90-131
DeadEnd Colorimetric TUNEL System	Promega	Cat#G7130
Target Retrieval‎ Solution	Dako	Cat#S1699
Protein Block Serum-Free	Dako	Cat#X0909
ENVISION+ System-HRP labeled Polymer Anti-Rabbit	Dako	Cat#K4002
VECTOR ImmPACT DAB Peroxidase Substrate	Vector Laboratories	Cat#SK4105
Lamina Propria Dissociation Kit	Miltenyi Biotec	Cat#130-097-410
Foxp3 / Transcription Factor Staining Buffer Set	eBioscience	Cat#00-5523-00
Rneasy Mini Kit	QIAGEN	Cat#74106
iScript Advanced cDNA Synthesis Kit for RT-qPCR	BIO RAD	Cat#1725038
Spotchem II glucose	Arkray	Cat#77301
Ketone-H kit	Serotech	Cat#A350
Experimental Models: Cell Lines
BLS12 cell	Katakai et al., 2004	N/A
Experimental Models: Organisms/Strains
Mouse: B6.B6129-Gt(ROSA)26Sor < tm1(CAG-kikGR) Kgwa > (KikGR mice)	RIKEN RBC	Cat# RBRC04847, RRID:IMSR_RBRC04847
Mouse: BALB/cA mice	CLEA Japan	N/A
Oligonucleotides
Cxcl13 (Mm00444533_m1)	Thermo Fisher Scientific	Cat# 4331182
Primer: Rpl32 Forward: GGCTTTTCGGTTCTTAGAGGA	Exigen	N/A
Primer: Rpl32 Reverse: TTCCTGGTCCACAATGTCAA-3′)	Exigen	N/A
Primer: Cxcl12 Forward: TTTCAGATGCTTGACGTTGG	Exigen	N/A
Primer: Cxcl12 Reverse: GCGCTCTGCATCAGTGAC	Exigen	N/A
Primer: Cxcl13 Forward: CTCCAGGCCACGGTATTCTG	Exigen	N/A
Primer: Cxcl13 Reverse: GGAGCTTGGGGAGTTGAAGA	Exigen	N/A
Primer; Ccl20 Forward: GGCAGAAGCAAGCAACTACG	Exigen	N/A
Primer; Ccl20 Reverse: CTTTGGATCAGCGCACACAG	Exigen	N/A
Software and Algorithms
Prism 8	GraphPad Software	RRID:SCR_002798
FlowJo Version 10	FlowJo, LCC	RRID:SCR_008520
DIVA software Version 6.2	BD Biosciences	RRID:SCR_001456
IMARIS Version 9.2.0	ZEISS	RRID:SCR_007370
ImageJ Software Version 1.49	NIH	RRID:SCR_003070
Other
Mouse diet: CE-2	CLEA Japan	N/A
Sporchem	Arkray	Cat#EZSP-4433
Fiber coupled Blue LED Light source	Prizmatix	Cat#Silver-LED-430
Dial-thickness gauge	Mitsutoyo	Cat#MDC-25PX

• Open table in a new tab

Lead Contact and Materials Availability

Further information and requests for reagents may be directed to, and will be fulfilled by the Lead Contact, Koji Hase (hase-kj@pha.keio.ac.jp)

Experimental Model and Subject DetailsMice

Unless otherwise stated, four to five-week-old male BALB/c mice were purchased from CLEA Japan Inc. (Tokyo, Japan) and were acclimated for one week under specific pathogen-free (SPF) conditions at the animal facilities of the National Center for Global Health and Medicine, Faculty of Pharmacy, Keio University (Tokyo, Japan). Knock-in mice carrying Kikume-Green Red (KikGR) cDNA under the CAG promoter were obtained from RIKEN RBC (Tokyo, Japan) and were maintained under SPF conditions at the animal facilities of Faculty of Pharmacy, Keio University (Tokyo, Japan). Germ-free (GF) BALB/cA mice (CLEA Japan Inc.) were maintained in GF vinyl isolators at an animal facility in the Faculty of Medicine, Keio University. SPF and GF mice were fed with CE-2 (CLEA Japan) and were kept under a 12:12 h light-dark cycle. During the fasting period, mice were kept in plastic cages without bedding chips or bait, with a stainless mesh floor to avoid coprophagia, and with ad libitum drinking water. Irrespective of the fasting and refeeding period length, refeeding or tissue collection was set to begin at 8:00 a.m. for all experiments. To examine the effect of rapamycin, 2DG and FTY720 in vivo, rapamycin (5 mg/kg; LC laboratories, Woburn, MA) was administrated intraperitoneally daily for seven consecutive days (Zeng et al., 2016), 2DG (250 mg/kg; Abcam, Cambridge, UK) was also administrated i.p. three times every 12 h (Varanasi et al., 2017), while FTY720 (1 mg/kg; Cayman Chemical Company, Ann Arbor, MI) was orally administrated three times every 12 h during fasting. All animal experiments were performed according to the Institutional Guidelines for the Care and Use of Laboratory Animals in Research with approval by the local ethics committees at the National Center for Global Health and Medicine, and Keio University.

Cell culture

BLS12 cells were cultured in DMEM (Sigma-Aldrich) supplemented with 10% FBS, GlutaMAX (GIBCO; Thermo Fisher Scientific), 1 mM sodium pyruvate (Sigma-Aldrich), and antibiotics, as previously described (Katakai et al., 2004). Cells were stimulated with 10 ng/mL murine TNF-α (PeproTech, Rocky Hill, NJ) and/or goat anti-mouse LTβR agonist antibodies (R&D Systems, Minneapolis, MN) for 24 h. In a separate experiment, BLS12 cells were cultured in glucose-deprived medium containing 10% FBS, GlutaMAX, MEM essential amino acids (Thermo Fisher Scientific), 1 mM sodium pyruvate, inorganic salts (1.8 mM CaCl2, 0.8 mM MgSO4, 5.3 mM KCl, 44 mM NaHCO3, 110 mM NaCl, and 0.9 mM NaH2PO4-H2O), and antibiotics in the presence of TNF-α and anti-LTβR antibodies for 24 h. Control medium was supplemented with 1 mg/ml glucose in the glucose-deprived medium. For pharmacological inhibition of mTORC1 or glycolysis, BSL12 cells were treated with medium containing various concentrations of rapamycin (LC Laboratories) or 2-deoxy-D-glucose (2DG; Abcam, Cambridge, UK) for 24 h. For analyzing the effect of β-hydroxybutyrate (BHB; Sigma-Aldrich), BLS12 cells were treated with medium containing 25 mM HEPES (GIBCO) with or without 4 mM BHB. For flow cytometric analysis, BLS12 cells were detached using Trypsin-EDTA solution (Nacalai Tesque, Kyoto, Japan) and washed with PBS. Mitochondrial reactive oxygen species (ROS) production was detected using MitoSOX-PE (Thermo Fisher Scientific) according to the manufacturer’s instructions.

Method DetailsPreparation of lymphocytes and BM cells

Peyer’s patches (PPs) were cut from the intestine and washed twice with phosphate-buffered saline (PBS; pH 7.2). PPs were then minced and stirred in 30 mL RPMI 1640 medium (pH 7.2; Sigma-Aldrich, St. Louis, MO) containing 2% fetal bovine serum (FBS; Sigma-Aldrich), 12.5 mM HEPES, 100 U/mL penicillin, 100 U/mL streptomycin, 0.5 mg/mL collagenase (Wako Pure Chemical Corporation, Osaka, Japan), and 0.5 mg/mL DNase I (Sigma-Aldrich) for 30 min at 37°C. After filtration through a 70-μm cell strainer, the cells were resuspended in PBS with 2% FBS. MLNs and CPs were mechanically dispersed into a single-cell suspension. Lamina propria cells of the small intestine were prepared using the Lamina Propria Dissociation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany) according to manufacturer’s instructions. BM cells from the right femur and tibia, and splenocytes were mechanically dispersed into a single-cell suspension. Red blood cells were removed by RBC lysis reagent (150 mM NH4Cl, 1 mM EDTA, and 0.4 mM NaHCO3) and then cells were suspended in PBS with 2% FBS.

Flow cytometry

For surface and intracellular staining, non-specific binding was blocked with Fc receptor antibody (clone: 2.4G2; Tonbo Biosciences, San Diego, CA) prior to staining with fluorochrome-conjugated antibodies. For intracellular staining, lymphocytes were fixed, permeabilized, and stained with monoclonal antibodies using the Foxp3 staining set (eBioscience, San Diego, CA) according to manufacturer’s instructions. 7-AAD (Tonbo Biosciences), Fixable Viability Dye eFluor 780 (Thermo Fisher Scientific, Waltham, MA), LIVE/DEAD Fixable Blue Dead Cell Stain Kit (Thermo Fisher Scientific), or SYTOX Blue Dead Cell Stain (Thermo Fisher Scientific) was used to discriminate dead cells. The stained samples were analyzed using LSR II, LSRFortessa, and Aria III flow cytometers with DIVA software (all from BD Biosciences, Franklin Lakes, NJ) and FlowJo software version 10 (FlowJo LLC, Ashland, OR).

Adoptive transfer of PP cells

PP cells from ad libitum-fed mice were prepared as described above. The cells were labeled with CellTrace Violet (Thermo Fisher Scientific) according to the manufacturer’s instructions and then suspended in PBS. The fluorescence-labeled cells (1 × 107 cells/mouse) were intravenously injected into recipient ad libitum-fed or 18 h-fasted recipients. Both groups were maintained under the same conditions after cell transfer. Eighteen hours later, transferred cells were detected in PPs, BM, and MLNs by flow cytometry.

Photoconversion of PPs from KikGR mice

Photoconversion of the PPs of KikGR mice was performed as described previously (Schmidt et al., 2013; Tomura et al., 2014). Briefly, KikGR mouse was anesthetized with isoflurane, shaved with an electric razor, and antiseptically prepared with 10% povidone-iodine. The skin was incised anteriorly at the midline below the costal margin, and then abdominal wall was incised. Each PP was sequentially drawn out from abdominal cavity, and the surgical site was covered by a piece of sterile aluminum foil with a 5 mm hole punched in it to leave only the PP exposed. A Silver LED 430 with a high numerical aperture polymer optical fiber light guide and fiber collimator (Prizmatix) was used as a 430-nm blue light source. Each PP was exposed for 2 minutes and immediately replaced into the peritoneal cavity to avoid drying. The abdominal cavity and skin were closed with 4–0 nylon suture (Natsume Seisakusho). After photoconversion surgery, the mice fasted for 36 h or fed ad libitum. Photoconverted cells in the BM, MLNs and the spleen were analyzed by a FACSAria III flow cytometer (BD Biosciences).

Oral immunization with OVA

In the fasting mouse group, 36-h fasts began at 8:00 p.m. on day 0. At 8:00 a.m. on day 4, all mouse groups were given 200 μL of 7.5% sodium bicarbonate in HBSS to neutralize gastric acid 1 h prior to oral immunization with 250 μL OVA (4 mg/mL; Sigma Aldrich) and CT (40 μg/mL; List Biological Laboratories, Campbell, CA) in PBS. This immunization protocol with or without fasting was repeated on day 7, 14, and 21. Fecal samples were collected on day 0, 18, 25, and 32 to measure OVA-specific IgA levels by enzyme-linked immunosorbent assays (ELISA), while plasma samples were collected on day 32 to measure OVA-specific IgM, IgA, and IgG levels by ELISA.

Detection of antibody responses by ELISA

To measure fecal IgA, fecal samples were homogenized in PBS (1 mL/100 mg feces) containing 1 × Complete Mini Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and 0.02% sodium azide (Wako Pure Chemical Corporation), followed by centrifugation to collect the supernatant as a fecal extract. Microlon ELISA plates (96-well; Greiner Bio-One, Kremsmünster, Austria) were coated with 1 mg/mL OVA in PBS at 4°C overnight. After washing, the wells were blocked with 4-fold diluted Block Ace (DS Pharma Biomedical, Saita, Japan) for 1 h at room temperature. After washing four times with PBS containing 0.05% Tween 20 (PBS-T), serially diluted plasma and fecal extracts were added in duplicate (100 μL/well). Fecal extracts from day 0 or plasma from non-immunized mice were included as a negative control. Horseradish peroxidase (HRP)-conjugated anti-mouse IgA, IgM, or IgG (Southern Biotech, Birmingham, AL) were used as antibodies. After incubation at room temperature for 1 h, the plates were extensively washed with PBS-T. Specific antibody binding was visualized by adding 3,3′,5,5′-tetramethylbenzidine as a substrate (Sigma-Aldrich) and then the reaction was terminated by 1.2 M H2SO4. Endpoint titers were expressed as the reciprocal log2 of the last dilution, giving OD450 values higher than control samples (Yamamoto et al., 1998). For measurements of plasma total IgG and fecal total IgA, Mouse IgG ELISA Quantitation Set (Bethyl Laboratories) and Mouse IgA ELISA Quantitation Set (Bethyl Laboratories) were used. For measurements of plasma total and OVA-specific IgE, ELISA MAX Mouse IgE (Biolegend) and LEGEND Mc Mouse OVA Specific IgE ELISA Kit with Pre-coated Plates (Biolegend) were used according to the manufacturer’s instructions.

Salmonella infection

rSalmonella–ToxC (ΔaroA, ΔaroD) and TT were kindly provided by the BIKEN Foundation (Osaka, Japan)(VanCott et al., 1996). Ad libitum or fasting group mice were orally immunized with 5 × 107 CFU of rSalmonella-ToxC on day 4. In the fasting group, 36-h fasts began at 8:00 p.m. on day 0, 17, and 31. TT-specific IgA in feces was measured by ELISA. Flat-bottomed, 96-well MaxiSorp Nunc-Immuno plates were coated overnight with 500 ng/well of TT. Plates were blocked with 2% BSA in PBS, and optically diluted fecal extracts and sera were added into the plate wells. The Mouse IgA ELISA Quantitation Set (Bethyl Laboratories) was used for antibody detection. To produce HRP signals were visualized by adding 3,3′,5,5′-tetramethylbenzidine as a substrate (Sigma-Aldrich) and then the reaction was terminated by 1.2 M H2SO4.

Food antigen-induced diarrhea model

To establish diarrhea, female mice were injected intraperitoneally with 100 μL OVA (1 mg/mL) and alum (1 mg/mL; Thermo Fisher Scientific) in PBS on day 0 and 7. Starting on day 14, OVA (50 mg) was administered orally every three days (on day 14, 17, and 20). In the fasting group, 36-h fasts began at 8:00 p.m. on day 10 and 17. The severity of allergic reactions to OVA was eval‎uated based on total and OVA-specific IgE in plasma and diarrhea occurrence, which was assessed by visually monitoring the mice for up to 1 h after oral challenge. Fecal and plasma samples were collected on day 14 and 20 to measure total and OVA-specific IgA and IgG, respectively.

Induction of oral tolerance

Mice in the fasting group were fasted for 36 h. After 36-h refeeding (9:00 a.m. on day 3), the mice were gavaged with 25 mg OVA in 200 μL PBS. Control mice received PBS only. On day 10, the mice were immunized subcutaneously with 100 μg OVA in 100 μL complete Freund’s adjuvant (CFA; Sigma-Aldrich). Delayed-type hypersensitivity (DTH) was measured on day 17 as described previously (Fujihashi et al., 2001). Briefly, 20 μL PBS containing 10 μg OVA was injected into the left ear pinna of the mice, while the right ear pinna received PBS as a negative control. After 24 h, ear swelling was measured using a dial thickness gauge (Mitutoyo, Kanagawa, Japan). The DTH response was expressed as the difference in ear thickness between the right and left ears. Plasma samples were collected on day 24 to measure OVA-specific IgG levels by ELISA.

Immunofluorescence

For immunostaining, PPs were snap-frozen in liquid nitrogen and embedded in OCT compound (Sakura, Tokyo, Japan). Frozen sections (4-μm thick) were fixed in dry ice-cold acetone for 15 min and then completely dried at room temperature for 1 h. After blocking with an anti-CD16/CD32 antibody (Tonbo Biosciences) in 10-fold diluted Block Ace (blocking buffer; DS Pharma Biomedical) for 30 min, the sections were incubated with primary antibodies (hamster monoclonal anti-mouse CD3ε; BD pharmagen, or rat monoclonal anti-mouse CD45R/B220; eBiosciences) in blocking buffer overnight at 4°C. Bound antibodies were detected with FITC-labeled anti-hamster (Southern Biotech) or TRITC-labeled anti-rat antibodies (Southern Biotech) and counterstained with DAPI. The sections were then examined with a confocal microscope (BX50; Olympus, Tokyo, Japan).

Frozen BM sections (10-μm thick) were prepared according to the Kawamoto method (Kawamoto, 2003; Yamazaki et al., 2011) and were fixed in 4% paraformaldehyde. After blocking with Protein Block (Dako, Jena, Germany) for 1 h, the fixed sections were washed with 0.3% (v/v) Triton X-100 in PBS and incubated with Alexa Fluor 488-conjugated anti-IgM antibodies (Thermo Fisher Scientific), anti-CD31 and anti-endomucin antibody, for 16 h at 4°C. The stained sections were again washed with 0.3% (v/v) Triton X-100 in PBS and further stained with DAPI and secondary antibodies (Alexa Fluor 633-conjugated anti-rat IgG; Thermo Fisher Scientific) for 4 h at room temperature. All antibodies were diluted in Protein Block. Immunofluorescence data were obtained and analyzed with a confocal laser scanning microscope (FV1000; Olympus). B cell number and the distance between naive B cells and vessels were determined using Imaris (Zeiss, Oberkochen, Germany) and ImageJ Software (NIH).

Histological analysis

PPs were fixed in 4% paraformaldehyde and embedded in paraffin. Tissue sections (3.5-μm thick) were then stained after deparaffinization. For histological examination, the sections were stained with hematoxylin (Dako) and eosin (Wako Pure Chemical Corporation). Antigen retrieval‎ was performed by autoclaving the sections in Target Retrieval‎ Solution (Dako). Then, the sections were treated with 3% H2O2 (Wako Pure Chemical Corporation) in methanol to inactivate endogenous peroxidase. After blocking with Protein Block Serum-Free (Dako) for 1 h, the sections were incubated with anti-cleaved Caspase-3 (0.5 μg/mL; Cell Signaling Technology, MA, USA) for 16 h at 4°C. After washing with PBS, sections were incubated with ENVISION+ System-HRP labeled Polymer Anti-Rabbit (Dako) for 30 min at room temperature. The ImmPACT™ DAB peroxidase substrate (Vector Laboratories) was used for diaminobenzidine staining, and hematoxylin was used for counterstaining. For TUNEL staining, the DeadEnd Colorimetric TUNEL System (Promega, Madison, WI) were used according to the manufacturer’s instructions. All sections were examined via confocal microscopy (BX50).

Transmission electron microscopy

PPs were pre-fixed in an aldehyde mixture (2% paraformaldehyde and 2% glutaraldehyde in 30 mM HEPES buffer containing 100 mM NaCl and 2 mM CaCl2; pH adjusted to 7.4) for 1 h at room temperature and post-fixed in an aldehyde-OsO4 mixture (1% OsO4, 1.25% glutaraldehyde, 1% paraformaldehyde, and 0.32% K3[Fe(CN)6] in 30 mM HEPES buffer; pH 7.4) for 1 h at room temperature. The fixed blocks were washed three times with Milli Q water (Milli Q Integral; Merck Millipore, Burlington, MA), dehydrated using a graded ethanol series, and then embedded in Quetol 812 (Nisshin EM, Tokyo, Japan). The resin blocks were sectioned (70-nm thick) using an ultramicrotome (EM UC7; Leica, Wetzlar, Germany), contrasted with uranyl acetate and lead citrate, and finally examined with a transmission electron microscope (JEM-1400; JEOL, Tokyo, Japan).

Reverse transcription and quantitative PCR

Total RNA from the BM was extracted using TRIzol Reagent (Thermo Fisher Scientific) while total RNA from PPs and BLS12 cells was isolated using the RNeasy Mini Kit (QIAGEN, Hilden, Germany) according to manufacturer’s instructions. RNA was reverse-transcribed to obtain cDNA using the iScript Advanced cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA). RT-qPCR was performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) or the CFX384 Real-Time System (Bio-Rad Laboratories) with SYBR Green (Applied Biosystems) and TaqMan assay (Roche). The oligonucleotide primers for Rpl32, Cxcl12, Cxcl13, and Ccl20 were purchased from Exigen (Tokyo, Japan). TaqMan assay probe for Cxcl13 was obtained from Applied Biosystems.

Bio-plex detection of phosphorylated proteins

Tissues were homogenized in 500 μL lysis solution (1X cell lysis factor QG and 2 mM phenylmethylsulfonyl fluoride in cell lysis buffer), vortexed, and placed on ice. The tissue homogenate was transferred to a microcentrifuge tube and frozen at −70°C. The samples were then thawed, sonicated, and centrifuged at 15,000 × g for 10 min, after which the supernatant was collected. Protein concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to manufacturer’s instructions. Lysates were adjusted to 200 μg/mL to detect the following key phosphorylated proteins of Akt downstream signaling, Akt (Ser473), BAD (Ser136), GSK-3α/β (Ser21/Ser9), IRS-1 (Ser636/Ser639), mTOR (Ser2448), PTEN (Ser280), p70 S6 kinase (Thr389), and S6 ribosomal protein (Ser235/Ser236), in PPs and the BM, followed by quantitative analysis with the Bio-Plex Phosphoprotein Assay (Bio-Plex Pro Cell Signaling Akt Panel; 8-plex #lq00006jk0k0rr; Bio-Rad Laboratories) and the Bio-Plex 3D System (Bio-Rad Laboratories) according to manufacturer’s instructions.

Plasma parameters

Plasma glucose levels were measured using Spotchem EZ SP-4430 (Arkray, Kyoto, Japan) with an automated dry chemistry system (Spotchem II; Arkray). Plasma BHB concentration was measured using the Serotec Ketone-H Kit (Serotec Co., Ltd., Sapporo, Japan) according to the manufacturer’s instructions.

Quantification and Statistical Analysis

For statistical analyses of two or more groups, we used Student’s t test or ANOVA followed by Tukey’s test. When variances were not homogeneous, the data were analyzed by the non-parametrical Mann-Whitney U test or the Dunnett’s test. Two-way ANOVA was applied to the time-course analysis of TT-specific IgA production. Differences with P-values < 0.05 were considered statistically significant. Statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, Inc., La Jolla, CA). The experiments were not randomized, and the investigators were not blinded to allocation during experiments and outcome assessment.

Acknowledgments

We thank Yuuki Obata, Yutaka Nakamura, Naomi Hoshina, Hiroaki Shiratori, Yuma Kabumoto, Hiyori Tanabe, Seiji Minegishi, and Teruki Hagiwara for technical support as well as Michio Tomura, Heiichiro Udono and Yun-Gi Kim for their valuable discussion and technical consultation. This work was supported by AMED-Crest (16gm1010004h0101 and 17gm1010004h0102; 18gm1010004h0103 to K. Hase), the Japan Society for the Promotion of Science (17KT0055, 16H01369, 18H04680, 25293114, and 26116709 to K. Hase), Keio Gijuku Academic Development Funds (to K. Hase), the SECOM Science and Technology Foundation (to K. Hase), the Takeda Science Foundation (to K. Hase.), the Science Research Promotion Fund, the Promotion and Mutual Aid Corporation for Private Schools of Japan (to K. Hase), Daiichi Sankyo Foundation of Life Science (to K. Hase), Terumo Foundation for Life Science and Arts (to K. Hase), Nagase Science Technology Foundation (to K. Hase), The Tokyo Biochemical Research Foundation (to K. Hase), the National Center for Global Health and Medicine (26-110 and 30-1006 to Y.I.K), Yoshida Scholarship Foundation (to M.N.), and Keio University Doctorate Student Grant-in-Aid Program (to M.N.).

Author Contributions

M.N. and R.N. performed most of the experiments and data analysis. M.N. wrote the manuscript. D.T., K.K., S.K., N.I., T.Y., Y.I.K., M.H., R.M., and M.S. helped with animal experiments. K. Hattori and R.A. performed GF mouse experiments. D.T. and K.M. performed KikGR mouse experiments. N.K. and Y.F. performed infection experiments. M.T.-N. performed electron microscopy analysis. T.Y. created the graphical abstract. Y.I.K. provided experimental resources and discussed data. T.K. provided the cell line. S.S. provided tetanus toxin. T.M. and K.T. analyzed the bone marrow data. T.D. conceived this study. K. Hase supervised the study. T.D. and K. Hase interpreted the data and revised the manuscript.

Declaration of Interests

The authors declare no competing interests.

Supplemental Information (1)

PDF (129.65 KB)

Table S1. Numbers of Lymphocytes, Granulocyte, Macrophages, Hematopoietic Stem Cells, and Multipotent Progenitors in the BM during Fasting and Refeeding, Related to Figure 2

The mean numbers of the indicated cell subsets (means ± SEM) in the BM of mice fed ad libitum, fasted for 36 h, or refed with CE2 for 48 h, as well as p value of ANOVA followed by Tukey’s test (each group, n = 9). CMP, common myeloid progenitor; GMP, granulocyte/macrophage progenitor; MEP, megakaryocyte/erythrocyte progenitor; MPP, multipotent progenitor; ST/LT-HSC, short term/long term-hematopoietic stem cell.

References

1.

Abbas, A.K. ∙ Lichtman, A.H. ∙ Pillai, S.

Cellular and molecular immunology

Elsevier, 2014 299-323

Google Scholar

2.

Aghamohammadi, A. ∙ Cheraghi, T. ∙ Gharagozlou, M. ...

IgA deficiency: correlation between clinical and immunological phenotypes

J. Clin. Immunol. 2009; 29:130-136

Crossref

Scopus (186)

PubMed

Google Scholar

3.

Allman, D. ∙ Pillai, S.

Peripheral B cell subsets

Curr. Opin. Immunol. 2008; 20:149-157

Crossref

Scopus (392)

PubMed

Google Scholar

4.

Ansel, K.M. ∙ Cyster, J.G.

Chemokines in lymphopoiesis and lymphoid organ development

Curr. Opin. Immunol. 2001; 13:172-179

Crossref

Scopus (165)

PubMed

Google Scholar

5.

Ansel, K.M. ∙ Ngo, V.N. ∙ Hyman, P.L. ...

A chemokine-driven positive feedback loop organizes lymphoid follicles

Nature. 2000; 406:309-314

Crossref

Scopus (1049)

PubMed

Google Scholar

6.

Basen-Engquist, K. ∙ Chang, M.

Obesity and cancer risk: recent review and evidence

Curr. Oncol. Rep. 2011; 13:7

ArticleVolume 178, Issue 5p1072-1087.e14August 22, 2019Open Archive

Download Full Issue

Fasting-Refeeding Impacts Immune Cell Dynamics and Mucosal Immune Responses

Motoyoshi Nagai1,2 ∙ Ryotaro Noguchi1,2 ∙ Daisuke Takahashi1 ∙ … ∙ Keiyo Takubo3 ∙ Taeko Dohi1,2 ∙ Koji Hase1,10,11 hase-kj@pha.keio.ac.jp … Show more

Affiliations & Notes

1Division of Biochemistry, Faculty of Pharmacy and Graduate School of Pharmaceutical Science, Keio University, Tokyo 105-8512, Japan

2Department of Gastroenterology, Research Center for Hepatitis and Immunology, Research Institute, National Center for Global Health and Medicine, Chiba 272-8516, Japan

3Department of Stem Cell Biology, Research Institute, National Center for Global Health and Medicine, Tokyo 162-8655, Japan

4Division of Gastroenterology and Hepatology, Department of Internal Medicine, Keio University School of Medicine, Tokyo 160-8582, Japan

5Institute of Health Sciences, Ezaki Glico Co., Ltd., Osaka 555-8502, Japan

6Communal Laboratory, Research Institute, National Center for Global Health and Medicine, Tokyo 162-8655, Japan

7Laboratory for Immunobiology, Graduate School of Medical Life Science, Yokohama City University, Kanagawa 230-045, Japan

8Department of Immunology, Graduate School of Medical and Dental Sciences, Niigata University, Niigata 951-8510, Japan

9Mucosal Vaccine Project, BIKEN Innovative Vaccine Research Alliance Laboratories, Research Institute for Microbial Diseases, Osaka University, Osaka 565-0871, Japan

10International Research and Development Center for Mucosal Vaccines, the Institute of Medical Science, the University of Tokyo (IMSUT), Tokyo 108-8639, Japan

11

[정일영]

문치연이 주목하는 fasting(금식)의 핵심 효과


1. autophagy
2. metabolic reprograming

세포의 energy sensing 기능 정상화 --> 특히 면역세포 정상화.