|
|
Limosilactobacillus reuteri fermented brown rice alleviates anxiety improves cognition and modulates gut microbiota in stressed mice
npj Science of Food volume 9, Article number: 5 (2025) Cite this article
Abstract
Chronic stress disrupts gut microbiota homeostasis, contributing to anxiety and depression. This study explored the effects of Limosilactobacillus reuteri fermented brown rice (FBR) on anxiety using an ICR mouse chronic mild stress (CMS) model. Anxiety was assessed through body weight, corticosterone levels, neurotransmitter profiles, and behavioral tests. A four-week FBR regimen reduced corticosterone, restored neurotransmitters like gamma-aminobutyric acid (GABA) and serotonin, and improved anxiety-related behaviors. Metagenomic (16S rRNA) and metabolomic analyses revealed enhanced amino acid metabolism, energy metabolism, and short-chain fatty acid (SCFA) production in FBR-treated mice. FBR-enriched beneficial gut bacteria, aligning the microbiota profile with that of non-stressed mice. FBR also modulated GABA receptor-related gene expression, promoting relaxation. Network pharmacology identified quercetin, GABA, glutamic acid, phenylalanine, and ferulic acid as bioactive compounds with neuroprotective potential. These findings highlight FBR’s potential as a gut-brain axis-targeted therapeutic for anxiety and stress-related disorders.
초록
만성 스트레스는
장내 미생물군집의 항상성을 교란시켜 불안과 우울증에 기여한다.
본 연구는 ICR 마우스 만성 경미 스트레스(CMS) 모델을 활용하여
Limosilactobacillus reuteri 발효 현미(FBR)가
불안에 미치는 영향을 탐구하였다.
불안은
체중, 코르티코스테론 수치, 신경전달물질 프로파일 및 행동 검사를 통해 평가하였다.
4주간의 FBR 투여는
코르티코스테론을 감소시키고,
감마-아미노부티르산(GABA) 및 세로토닌과 같은 신경전달물질을 회복시키며,
불안 관련 행동을 개선했다.
메타게놈(16S rRNA) 및 대사체 분석 결과,
FBR 처리 마우스에서 아미노산 대사,
에너지 대사 및 단쇄지방산(SCFA) 생산이 증가한 것으로 나타났다.
FBR은
유익한 장내 세균을 풍부하게 하여
미생물군집 프로파일을 스트레스 받지 않은 쥐와 유사하게 조정했습니다.
FBR은
또한 GABA 수용체 관련 유전자 발현을 조절하여 이완을 촉진했습니다.
네트워크 약리학 분석을 통해
케르세틴, GABA, 글루탐산, 페닐알라닌, 페룰산이 신경보호 잠재력을 지닌
생리활성 화합물로 확인되었습니다.
이러한 결과는
FBR이 불안 및 스트레스 관련 장애에 대한
장-뇌 축 표적 치료제로서의 잠재력을 강조한다.
Similar content being viewed by others
Perturbations in the microbiota-gut-brain axis shaped by social status loss
Article Open access08 March 2025
Article Open access16 October 2020
Article Open access03 April 2025
Introduction
Stress is a complex response that includes both physiological and psychological reactions to an individual’s perception of a threat or challenge, often referred to as a stressor. Although some stress can be advantageous in limited amounts, chronic stress can adversely affect mental and physical well-being, culminating in conditions such as depression and anxiety. The World Health Organization (WHO) acknowledges stress as a crucial health issue, predicting that stress-linked disorders will be the world’s second primary cause of disability by 2030 https://www.who.int/health-topics/mental-health. According to WHO, stress and anxiety are major factors in the worldwide disease burden, ranking anxiety disorders as the sixth primary cause of disability globally. Depression and anxiety, two of the most prevalent mental health conditions, are estimated to cost the global economy US$ 1 trillion annually. Research conducted by Baxter et al.1 indicates that individuals with anxiety disorders are more susceptible to experiencing other health issues, such as cardiovascular disease and respiratory disorders. Furthermore, studies have demonstrated that exposure to stressors can significantly impact the microbiota, which plays a vital role in regulating the body’s stress response and may contribute to the development of various other health conditions2.
소개
스트레스는
개인이 위협이나 도전(종종 스트레스 요인이라고 함)을 인식할 때 나타나는
생리적, 심리적 반응을 모두 포함하는 복잡한 반응입니다.
일정 수준의 스트레스는 유익할 수 있으나,
만성 스트레스는 정신적·신체적 건강에 부정적 영향을 미쳐
우울증 및 불안 장애와 같은 상태로 이어질 수 있습니다.
세계보건기구(WHO)는
스트레스를 중대한 건강 문제로 인정하며,
2030년까지 스트레스 관련 장애가 전 세계 장애 발생의 두 번째 주요 원인이 될 것이라고 예측합니다 https://www.who.int/health-topics/mental-health.
WHO에 따르면 스트레스와 불안은
전 세계 질병 부담의 주요 요인으로,
불안 장애는 전 세계 장애 발생의 6번째 주요 원인으로 꼽힙니다.
가장 흔한 정신 건강 문제인 우울증과 불안은
전 세계 경제에 연간 1조 달러의 비용을 초래하는 것으로 추정됩니다.
Baxter 등의 연구1에 따르면
불안 장애를 가진 사람들은 심혈관 질환 및 호흡기 질환과 같은
다른 건강 문제를 경험할 가능성이 더 높습니다.
또한 연구에 따르면 스트레스 요인에 노출되면
신체 스트레스 반응 조절에 핵심적인 역할을 하는 미생물군집에 상당한 영향을 미칠 수 있으며,
이는 다양한 다른 건강 상태의 발병에 기여할 수 있습니다2.
Historically, fermentation was primarily used to preserve and ensure the safety of perishable foods. Over time, it has evolved into a sophisticated process for the production of fermented products with improved sensory qualities, enhanced nutritional value, and health-promoting attributes. This transformation has cemented fermented foods as a staple in many cultural cuisines worldwide3. Globally, fermented foods make up an estimated 30% of the average diet4. A growing body of research highlights the health benefits associated with fermented food consumption3,5,6,7,8. Probiotics, as defined by the WHO, are “live microorganisms that, when administered in adequate amounts, confer a health benefit on the host.” Among probiotics, lactic acid bacteria (LAB) stand out for their well-established safety and diverse bioactive properties. This has led to their exploration as potential bioengineering platforms, or cell factories, for producing beneficial compounds9. LAB are commonly used as starter cultures in the fermentation of various foods for both domestic and commercial applications10. The term “psychobiotics” has recently been introduced to describe a new class of probiotics with potential psychiatric applications11. These probiotics are capable of producing neuroactive substances, such as gamma-aminobutyric acid (GABA) and serotonin, which are known to influence the brain-gut axis. Psychobiotics are thought to reduce cortisol (the “stress hormone”) levels while increasing oxytocin (the “cuddle hormone”), potentially benefiting mental health12,13. The genus Lactobacillus represents a large, diverse group of Gram-positive, non-sporulating, facultatively anaerobic bacteria. Common species include Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus casei, and Limosilactobacillus reuteri14. In recent years, interest in probiotics has surged, driven by rising antibiotic resistance, particularly, in the treatment of gastrointestinal diseases, and a growing public preference for natural health-promoting alternatives15.
역사적으로 발효는
주로 부패하기 쉬운 식품의 보존과 안전성 확보를 위해 사용되었습니다.
시간이 지나면서 발효는
감각적 품질 향상, 영양가 증대, 건강 증진 특성을 지닌
발효 제품 생산을 위한 정교한 공정으로 발전했습니다.
이러한 변화로 발효 식품은
전 세계 수많은 문화권에서 주요 식재료로 자리매김했습니다3.
전 세계적으로 발효 식품은
평균 식단의 약 30%를 차지하는 것으로 추정됩니다4.
발효 식품 섭취와 관련된 건강상의 이점을 강조하는 연구 결과도
WHO가 정의한 프로바이오틱스는
“적정량을 투여할 경우 숙주에게 건강상의 이점을 제공하는 생체 미생물”입니다.
프로바이오틱스 중에서도 유산균(LAB)은
확립된 안전성과 다양한 생리활성 특성으로 두각을 나타냅니다.
이로 인해 유익한 화합물 생산을 위한
잠재적 생물공학 플랫폼 또는 세포 공장으로서의 연구가
진행되고 있습니다9.
LAB는
가정용 및 상업용 다양한 식품 발효 시
시동균으로 흔히 사용됩니다10.
최근 정신의학적 적용 가능성이 있는
새로운 종류의 프로바이오틱스를 설명하기 위해
“사이코바이오틱스(psychobiotics)”라는 용어가 도입되었습니다11.
이러한
프로바이오틱스는
감마-아미노부티르산(GABA) 및 세로토닌과 같은 신경활성 물질을 생성할 수 있으며,
이 물질들은 뇌-장 축에 영향을 미치는 것으로 알려져 있습니다.
사이코바이오틱스는
코르티솔(‘스트레스 호르몬’) 수치를 낮추면서
옥시토신(‘포옹 호르몬’)을 증가시켜 정신 건강에 잠재적으로 이롭다고 여겨집니다12,13.
Lactobacillus 속은
그람 양성, 비포자 형성, 선택적 혐기성 세균으로 구성된 크고 다양한 그룹을 대표한다.
일반적인 종으로는
Lactobacillus acidophilus,
Lactobacillus rhamnosus,
Lactobacillus bulgaricus,
Lactobacillus casei,
Limosilactobacillus reuteri 등이 있다14.
최근 몇 년간 항생제 내성 증가,
특히 위장관 질환 치료에서의 내성 증가와 자연 건강 증진 대안에 대한
대중의 선호도 증가로 인해 프로바이오틱스에 대한 관심이 급증했습니다15.
The gastrointestinal tract hosts a diverse array of microorganisms that maintain mutually beneficial relationships with their human host. Central to this dynamic is the gut-brain axis, a bidirectional communication network linking the central nervous system (CNS) and the enteric nervous system. This axis enables the coordinated regulation of gastrointestinal functions and has recently emerged as a critical area of study16. Research has shown that this communication pathway not only regulates digestive processes but also influences stress levels, highlighting the intricate interplay between the gut microbiome and overall human health17,18. Stress can disrupt the gut-brain axis through various mechanisms, including alterations in gut microbiota composition, increased intestinal permeability, and immune system dysregulation. These changes can impair the axis’s normal functioning and contribute to the onset of stress-related gastrointestinal disorders such as irritable bowel syndrome (IBS) and functional dyspepsia. Evidence suggests that these gastrointestinal disorders often precede the development of anxiety and depression in many patients19. Studies involving germ-free mice have demonstrated a heightened stress response in the hypothalamic-pituitary-adrenal (HPA) axis, emphasizing the gut microbiome’s influence on neurophysiology20. Additionally21 stress-induced changes in the gut-brain axis have been linked to immune cell activation in the gut, triggering inflammation and exacerbating conditions like IBS. These findings underscore the critical role of the gut microbiome in shaping both physical and mental health, offering new insights into the relationship between gut health, behavior, and neurophysiological processes.
위장관은
인간 숙주와 상호 유익한 관계를 유지하는
다양한 미생물을 보유하고 있습니다.
이러한 역학의 핵심은
중추신경계(CNS)와 장신경계를 연결하는 양방향 통신 네트워크인 장-뇌 축이다.
이 축은
위장 기능의 협응력 있는 조절을 가능하게 하며
최근 중요한 연구 분야로 부상했다16.
연구에 따르면 이 통신 경로는
소화 과정을 조절할 뿐만 아니라 스트레스 수준에도 영향을 미쳐
장내 미생물군집과 전반적인 인간 건강 사이의 복잡한 상호작용을 부각시킨다17,18.
스트레스는
장내 미생물군 구성 변화, 장 투과성 증가, 면역 체계 이상 조절 등
다양한 기전을 통해 장-뇌 축을 교란할 수 있습니다.
이러한 변화는
축의 정상적 기능을 저해하고 과민성 대장 증후군(IBS) 및 기능성 소화불량과 같은
스트레스 관련 위장관 장애 발병에 기여합니다.
많은 환자에서
이러한 위장관 장애가 불안 및 우울증 발병보다 선행한다는 증거가 제시되고 있습니다19.
무균 마우스를 대상으로 한 연구에서는
시상하부-뇌하수체-부신(HPA) 축에서 스트레스 반응이 증가하는 것이 확인되었으며,
이는 장내 미생물군이 신경생리학에 미치는 영향을 강조한다20.
또한21 스트레스에 의한 장-뇌 축의 변화는
장 내 면역 세포 활성화와 연관되어 염증을 유발하고
IBS와 같은 상태를 악화시키는 것으로 밝혀졌습니다.
이러한 연구 결과는
장내 미생물 군집이 신체적·정신적 건강 형성에 핵심적인 역할을 한다는 점을 강조하며,
장 건강, 행동, 신경생리학적 과정 간의 관계에 대한 새로운 통찰을 제공합니다.
The connection between gut microbiota and brain function has sparked significant interest, particularly regarding the potential of probiotic or psychobiotics strains to influence cognitive performance and mental health. Dietary interventions, such as consuming probiotics or incorporating probiotic-rich foods, are increasingly recommended for enhancing host health by modulating the composition and activity of gut microbiota22,23,24. For instance, a randomized controlled trial reported significant reductions in anxiety symptoms in individuals with generalized anxiety disorder after eight weeks of supplementation with a blend of Lactobacillus acidophilus, Lactobacillus casei, Bifidobacterium bifidum, and Lactobacillus fermentum25,26,27. Similarly, trials involving Lactobacillus plantarum strains, such as DR7 and P8, demonstrated notable reductions in stress symptoms over eight to twelve weeks, as assessed using the perceived Stress Scale (PSS-10)28,29. Furthermore, numerous studies suggest that consuming probiotics fermented grains like brown rice may offer various health benefits30,31. Brown rice is also an excellent source of B vitamins, which are essential for regulating mood. Likewise, a review by Casertano et al. 32 suggested that consumption of psychobiotics and fermented foods, can have positive effects on mental health. Although further research is needed to confirm the findings, there is potential for functional foods, fermented foods, and probiotics or psychobiotics to serve as interventions for alleviating symptoms associated with stress, anxiety, and related disorders. Moreover, in our prior research articles, we have elucidated the benefits of fermented brown rice (FBR) for human well-being through in vitro and ex vivo analysis24,30,33,34. To investigate the potential benefits of psychobiotic-FBR for alleviating stress-related symptoms, we have conducted this comprehensive study using a mouse model of chronic restraint stress. This study involved a variety of behavioral tests to assess anxiety, depression, and cognitive function. We also measured key stress biomarkers, such as corticosterone, IL-6, and TNF-α, as well as neurotransmitters like GABA and serotonin, to explore the underlying mechanisms. In addition, we employed advanced techniques, including metagenomics (16S rRNA) and metabolomics, to investigate stress-induced alterations in metabolites and cecal microbiota. We also analyzed in silico network pharmacology studies to identify primary metabolites and their associated pathways involved in alleviating stress-related disorders. To further understand the pathophysiology of stress and anxiety, we examined the expression of GABA receptors in the prefrontal cortex across normal, stressed, and treated groups, which provided insights into the efficacy of psychobiotics and fermented foods as potential therapies for mental health.
장내 미생물군과 뇌 기능 간의 연관성은
특히 프로바이오틱스 또는 사이코바이오틱스 균주가
인지 기능과 정신 건강에 미치는 잠재적 영향에 대한 상당한 관심을 불러일으켰습니다.
프로바이오틱스 섭취나 프로바이오틱스가 풍부한 식품 섭취와 같은 식이 중재는
장내 미생물군의 구성과 활동을 조절함으로써
숙주 건강을 증진시키기 위해 점점 더 권장되고 있습니다22,23,24.
예를 들어, 무작위 대조 시험에서는
Lactobacillus acidophilus, Lactobacillus casei, Bifidobacterium bifidum,
Lactobacillus fermentum 혼합물을 8주간 보충한 후 일반화된 불안 장애를 가진
개인의 불안 증상이 현저히 감소했다고 보고했습니다25,26,27.
https://pmc.ncbi.nlm.nih.gov/articles/PMC5102282/
https://link.springer.com/article/10.2991/jaims.d.200420.001
마찬가지로, DR7 및 P8과 같은 Lactobacillus plantarum 균주를 포함한 시험에서는 인지된 스트레스 척도(PSS-10)를 사용하여 평가한 결과, 8~12주 동안 스트레스 증상이 현저히 감소한 것으로 나타났습니다28,29.
또한, 수많은 연구에 따르면
현미와 같은 발효 곡물을 섭취하는 프로바이오틱스가
다양한 건강상의 이점을 제공할 수 있다고 제안합니다30,31.
현미는 기분 조절에 필수적인
B 비타민의 훌륭한 공급원이기도 합니다.
마찬가지로 Casertano 등의 리뷰32는
사이코바이오틱스와 발효 식품 섭취가 정신 건강에 긍정적 영향을 미칠 수 있음을 시사합니다.
연구 결과를 확인하기 위해서는 추가 연구가 필요하지만,
기능성 식품, 발효 식품, 프로바이오틱스 또는 사이코바이오틱스가
스트레스, 불안 및 관련 장애와 연관된 증상 완화를 위한 중재 수단으로 활용될 잠재력이 있습니다.
또한, 우리의 이전 연구 논문에서 우리는
시험관 내 및 생체 외 분석을 통해 발효 현미(FBR)가
인간의 웰빙에 미치는 이점을 밝혔습니다24,30,33,34.
스트레스 관련 증상 완화를 위한 사이코바이오틱-FBR의 잠재적 이점을 조사하기 위해,
만성 구속 스트레스 마우스 모델을 활용한 본 포괄적 연구를 수행하였다.
본 연구는
불안, 우울증 및 인지 기능을 평가하기 위한 다양한 행동 검사를 포함하였다.
또한
코르티코스테론, IL-6, TNF-α와 같은 주요 스트레스 생체지표와
GABA, 세로토닌과 같은 신경전달물질을 측정하여
근본적인 기전을 탐구했습니다.
더불어
메타게놈학(16S rRNA) 및 대사체학 등 첨단 기법을 활용하여
스트레스 유발 대사체 및 맹장 미생물군 변화도 조사했습니다.
스트레스 관련 장애 완화에 관여하는 주요 대사산물과 관련 경로를 규명하기 위해
컴퓨터 기반 네트워크 약리학 연구도 분석했습니다.
스트레스와 불안의 병리생리학적 기전을 심층 이해하기 위해
정상군, 스트레스군, 치료군에서 전전두엽 피질의 GABA 수용체 발현을 조사했으며,
이는 정신 건강 치료제로서의 심리생물제 및 발효식품 효능에 대한 통찰을 제공했습니다.
To the best of our knowledge, this is the first study to use the psychobiotic Limosilactobacillus reuteri strain, isolated from human breast milk, for the fermentation of brown rice to address chronic stress and its associated disorders. The whole-genome analysis of this strain, which reveals its ability to produce neurotransmitters like GABA24, adds a unique dimension to our research. Our study comprehensively evaluates the effects of FBR on stress-induced anxiety, gut microbiota alterations, and neurotransmitter regulation. Through a combination of behavioral testing, neurotransmitter profiling, serum metabolomics, and metagenomic analysis, we assess the multifaceted impact of FBR. Importantly, our findings show that FBR modulates gut microbiota composition, boosts the production of beneficial metabolites like short-chain fatty acids (SCFAs), and restores neurotransmitter balance in a chronic stress model. These results significantly contribute to the development of functional foods aimed at improving mental health, offering fresh insights into the complex relationship between the gut microbiota, metabolites, and the gut-brain axis. Our research highlights the potential of psychobiotic-fermented foods as a promising approach for enhancing psychological resilience and overall well-being.
우리의 지식 범위 내에서,
이는 만성 스트레스 및 관련 장애를 해결하기 위해
인간 모유에서 분리된 정신생물학적 유산균 Limosilactobacillus reuteri 균주를
현미 발효에 사용한 최초의 연구입니다.
이 균주의 전체 게놈 분석은
GABA와 같은 신경전달물질 생성 능력을 밝혀내며24,
우리 연구에 독특한 차원을 더합니다.
본 연구는 FBR이
스트레스 유발 불안, 장내 미생물군 변화, 신경전달물질 조절에 미치는 영향을
종합적으로 평가한다.
행동 검사, 신경전달물질 프로파일링, 혈청 대사체학 및 메타게놈 분석을 결합하여
FBR의 다각적 영향을 평가합니다.
특히, FBR이 장내 미생물군 구성 조절,
단쇄지방산(SCFAs)과 같은 유익한 대사산물 생산 촉진,
만성 스트레스 모델에서의 신경전달물질 균형 회복을 보여주는 것이 중요합니다.
이러한 결과는
정신 건강 개선을 목표로 하는 기능성 식품 개발에 크게 기여하며,
장내 미생물군집, 대사산물, 장-뇌 축 간의 복잡한 관계에 대한 새로운 통찰을 제공한다.
본 연구는 심리적 회복력과 전반적인 웰빙 향상을 위한 유망한 접근법으로서
정신생물학적 발효 식품의 잠재력을 부각시킨다.
Results and discussion
Confirmation of chronic stress induction
Administering chronic restraint stress daily for two weeks effectively induced significant anxiety-related behaviors in EPMT, disrupted cognitive function in NOR test, and elicited depression-related behaviors in the FST. Stressed mice also exhibited a reduction in weight compared to the normal group (Fig. 1a). In the EPMT and NOR, stressed mice spent less time in and made fewer entries into the center and preferred closed arms reflecting heightened anxiety (Fig. 1b, c), compared to the normal group, also, stressed mice were unable to distinguish between the two objects indicating disrupted cognitive function. Additionally, FST showed increased immobility, indicating despair-like behavior (Fig. 1d) along with elevated corticosterone levels (Fig. 1e) confirming chronic stress has the potential to induce anxiety-like behaviors in mice and provides validation for our stress protocol. Numerous studies have established a robust association between stress and the onset of anxiety and its related conditions. This explains the connection between the disruption of the HPA axis, resulting in an excessive release of glucocorticoids (such as corticosterone). This, in turn, triggers biochemical and neurochemical alterations that impact the brain’s intracellular redox status in rodents35.
만성 스트레스 유도 확인
2주간 매일 만성 구속 스트레스를 시행한 결과, EPMT에서 유의미한 불안 관련 행동이 유발되었고, NOR 테스트에서 인지 기능 장애가 관찰되었으며, FST에서 우울 관련 행동이 나타났습니다. 스트레스를 받은 마우스는 대조군에 비해 체중 감소도 보였습니다(그림 1a). EPMT 및 NOR에서 스트레스를 받은 쥐들은 정상군에 비해 중심부에서 보내는 시간과 진입 횟수가 적었으며, 폐쇄된 팔을 선호하는 등 불안이 증가한 모습을 보였습니다(그림 1b, c). 또한 스트레스를 받은 쥐들은 두 개체를 구분하지 못하여 인지 기능 장애를 나타냈습니다. 또한 FST에서는 움직임이 증가하여 절망과 유사한 행동을 보였으며(그림 1d), 코르티코스테론 수치 상승(그림 1e)이 관찰되어 만성 스트레스가 쥐에게 불안 유사 행동을 유발할 수 있음을 확인하고 본 연구의 스트레스 프로토콜 유효성을 입증하였다. 수많은 연구를 통해 스트레스와 불안 및 관련 질환 발병 간 강력한 연관성이 입증되었다. 이는 HPA 축 장애로 인한 글루코코르티코이드(코르티코스테론 등) 과다 분비와의 연관성을 설명한다. 이는 다시 설치류의 뇌 세포 내 산화환원 상태에 영향을 미치는 생화학적·신경화학적 변화를 유발한다35.
Fig. 1: Confirmation of stress induction.
a Body weight and food take analysis. b Behavior analysis-Elevated plus-maze test (EPMT). c Behavior analysis-Novel object recognition test (NOR). d Behavior analysis-Forced swim test (FST). and e Corticosterone stress hormone analysis.
Psychobiotics FBR significantly improved anxiety-related behavior and cognitive functionBody weight and food intake analysis
After administering varying doses of FBR (low, medium, and high), enhancements were observed in the body weight index. Notably, the stressed group exhibited the lowest weight. As explained earlier, activation of the HPA axis results in the upregulation of corticosterone, increased metabolic rate, and energy expenditure, which can lead to weight loss, especially when energy intake does not meet the elevated energy demands. Elevated levels of corticosterone may suppress appetite by directly affecting brain regions involved in hunger regulation, such as the hypothalamus, or by altering the levels of hormones that control hunger36. The interventions involving FBR and the drug led to weight improvements, particularly in stressed mice, with the medium and high doses of FBR yielding significant results. However, no notable differences were noted in food intake (Fig. 2a (a, b)). These divergent outcomes in body weight gain underscore the significance of both the dietary regimen and the FBR dosage in investigating the effects of FBR on ICR mice subjected to chronic stress. Therefore, further behavioral analyses were conducted to gain a deeper understanding of the effects of FBR on chronic stress.
다양한 용량의 FBR(저용량, 중용량, 고용량) 투여 후 체중 지수에서 개선이 관찰되었다. 특히 스트레스 그룹이 가장 낮은 체중을 보였다. 앞서 설명한 바와 같이, HPA 축 활성화는 코르티코스테론의 상향 조절, 대사율 증가 및 에너지 소비를 초래하여, 특히 에너지 섭취가 증가된 에너지 수요를 충족시키지 못할 경우 체중 감소로 이어질 수 있다. 코르티코스테론 수치 상승은 시상하부 등 식욕 조절 관련 뇌 영역에 직접 영향을 주거나, 식욕을 제어하는 호르몬 수치를 변화시켜 식욕을 억제할 수 있다36. FBR 및 약물 투여 개입은 특히 스트레스를 받은 마우스에서 체중 개선을 가져왔으며, 중간 및 고용량 FBR 투여 시 유의미한 결과가 나타났다. 그러나 사료 섭취량에서는 뚜렷한 차이가 관찰되지 않았다(그림 2a (a, b)). 체중 증가에 대한 이러한 상이한 결과는 만성 스트레스를 받은 ICR 생쥐에서 FBR의 효과를 연구할 때 식이 요법과 FBR 용량 모두의 중요성을 강조한다. 따라서 만성 스트레스에 대한 FBR의 효과를 더 깊이 이해하기 위해 추가 행동 분석을 수행하였다.
Fig. 2: Effects of Fermented Brown Rice on Body Weight, Behavior, and Biochemical Parameters in Chronically Stressed Mice.
a Effects of FBR on the changes of body weight and food intake in the chronic stressed mice. a The change in body weight and b the changes in food intake of mice. Statistical analysis was performed using one-way ANOVA. The represent the means ± S.E.M. (n = 7 per group). ***p < 0.001 versus the normal group. b Effect of fermented brown rice on anxiety-like behavior in the chronically stressed mice. A tracking area, B The time spent in open arms, C The time spent in close arms, and D The time spent in center zone. Statistical analysis was performed using one-way ANOVA. The data represent the means ± S.E.M. (n = 7 per group). ##p < 0.01, ###p < 0.001 versus the normal group; *p < 0.05, **p < 0.01, ***p < 0.001 versus the stress-only group. c Effect of fermented brown rice on memory deficits in the chronic stressed mice. A Object preference ratio of each object, B Discrimination ratio, and C The total exploration time are represented. Statistical analysis was performed using one-way ANOVA. The comparison between familiar object and novel object using t test (a). The data represent the means ± S.E.M. (n = 7 per group). *p < 0.05, ***p < 0.001 (t test); #p < 0.001, versus the normal; *p < 0.05, ***p < 0.001 versus the stress-only group. d Effect of fermented brown rice on locomotion behavior in the chronic stressed mice. A Tracking area, B Distance moved in box, C Distance moved spent in the center zone divided by total distance moved and D Distance moved spent in the periphenal zone divided by total distance moved. Statistical analysis was performed using one-way ANOVA. The data represent the means ± S.E.M. (n = 7 per group) *p < 0.05, ***p < 0.001 versus the stress-only group. e Effect of fermented brown rice on depression in the chronic stressed mice. The immobility time in FST. Statistical analysis was performed using one-way ANOVA. The represent the means ± S.E.M. (n = 7 per group). *p < 0.05 versus the stress-only group #p < 0.001. f Effect of fermented brown rice on stress hormone corticosterone and neurotransmitter GABA & Serotonin in the chronic stressed mice. a presents effect of fermented brown rice on stress hormone corticosterone, whereas b, c represents effect of fermented brown rice on neurotransmitter GABA & Serotonin in the chronic stressed mice. The data represent the means ± S.E.M. (n = 7 per group). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus the stress-only group. g Effect of fermented brown rice on IL-6 and TNF-α in the chronic stressed mice (a, b). a shows the effect of fermented brown rice on IL-6, while b depicts its effect on TNF-α compared to the control and stressed groups.The data represent the means ± S.E.M. (n = 7 per group). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus the stress-only group. Normal normal or No stress, FBR Fermented brown rice, Drug (Flu) Fluoxetine, LD Low dose, MD Medium dose, HD High dose, S Stress.
Elevated plus-maze test (EPMT)
The treatment groups of mice demonstrated significant differences in their behavior during EPMT analysis. Particularly, the stressed group spent significantly less time in the open arms and center zone of the maze compared to the normal control and treatment groups. Post hoc analysis further illustrated that chronic stress led to a significant reduction in the time spent in the open arms compared to the normal group (p < 0.01). As demonstrated in Fig. 2b (A-D), the administration of different doses of FBR to the mice displayed noteworthy effects. Specifically, the low and medium doses of FBR led to a reversal in the reduced time spent in the open arms (p < 0.05) and the central zone (p < 0.01, p < 0.05, respectively) of the EPMT. Additionally, these FBR doses significantly reduced the time spent in the closed arms (p < 0.01, p < 0.05, respectively), which had been elevated due to chronic stress. These findings collectively emphasize the anxiolytic-like properties of FBR, as it counteracted the anxiety-inducing effects of chronic stress, thereby restoring more balanced behavior in the EPMT.
Novel object recognition test (NOR)
The intervention with FBR significantly improved the discrimination ratio (%) between familiar and novel objects, with the effect being most pronounced at medium and high doses of FBR (p < 0.001) in the NOR test. This effect contrasted sharply with the stressed group, where the mice were unable to distinguish between the two objects (p < 0.001). Markedly, no significant differences were observed in the total exploration time (in seconds) across the experimental groups. These findings highlight that the improvement in cognitive function observed with FBR treatment was not accompanied by changes in overall exploration behavior. Figure 2c (A-C) presents the results, showing an increase in cognitive discrimination following FBR administration. This suggests that FBR, particularly when administered at medium and high doses, may help alleviate stress-induced cognitive impairments, as evidenced by the results of the novel object recognition test.
Open field test
OFT is used as a prominent behavioral assay within rodent research, serving as a valuable tool to evaluate exploratory and anxiety-related behaviors. This test delves into the complex relationship between rodents’ emotional states and their tendency to seek novelty by evaluating factors such as total distance traveled and the amount of time spent in the center versus the peripheral areas. Functionally, the Open Field Test (OFT) provides insight into the animals’ emotional states, evaluating their tendency to explore unfamiliar areas and their sensitivity to anxiety-inducing stimuli. Typically, a preference for spending more time in the open center of the arena is considered an indicator of lower anxiety, as the center is less protective compared to the peripheral edges. Conversely, a preference for the periphery indicates heightened anxiety. During our analysis, we focused on the frequency of entries made into the center. Noticeably, mice subjected to chronic stress showed a significant decrease in center entries, suggesting increased anxiety-like behavior. In contrast, the FBR-treated group led to a marked improvement, displaying a significant increase in both the time spent and locomotion within the center of the arena. This effect was particularly asserted in the medium dose group (p < 0.05), as depicted in Fig. 2d (A-D). However, it is noteworthy that no significant differences were observed in the ratio of peripheral distance to total distance among the experimental groups. This suggests that while FBR treatment increased center exploration and locomotion, it did not substantially alter the overall mobility patterns of the animals. In summary, the OFT provides valuable insights into how rodents interact with their environment, highlighting the complex dynamics between stress, intervention, and exploratory behavior. The findings emphasize FBR’s potential to modulate anxiety responses, particularly through increased engagement with the center of the arena.
Forced swim test
FST is a pivotal assay frequently employed for assessing the efficacy of antidepressants. In this paradigm, the duration of immobility serves as a key metric, providing insight into the response of the stressed model. Immobility time in the FST is a behavioral marker indicative of helplessness, a central feature of this test. Clearly, the group subjected to chronic stress exhibited a significant increase in immobility duration (p < 0.001). This prolonged immobility period underscores the induction of a helpless-like state, consistent with the established interpretation of this behavioral outcome. In comparison, the normal group and those treated with FBR exhibited different responses. The stressed group showed a significantly longer immobility period compared to the normal and FBR-treated groups, indicating the efficacy of FBR in reducing stress-induced despair-like behavior (p < 0.05). FBR treatment significantly increased the time spent in active swimming while decreasing immobility time (p < 0.05), as illustrated in Fig. 2e. These results suggest that FBR can modulate behavioral responses related to stress-induced helplessness, with the reduction in immobility time and the increase in active swimming indicating potential antidepressant-like effects. This supports the broader utility of the FST in screening compounds with mood-enhancing properties and suggests that FBR may help mitigate stress-related behavioral changes.
Given the positive impact of FBR on behavioral outcomes, additional hormonal analyses were conducted to gain a more comprehensive understanding of the impact of FBR on chronic stress. This will allow us to understand whether FBR can modulate stress responses at the hormonal level, thereby complementing the behavioral improvements observed in the study.
고도 플러스 미로 검사(EPMT) (EPMT)
EPMT 분석에서 치료군 마우스들은 행동에 유의미한 차이를 보였습니다. 특히 스트레스군은 정상 대조군 및 치료군에 비해 미로 내 개방 팔과 중앙 영역에서 유의하게 적은 시간을 보냈습니다. 사후 분석 결과 만성 스트레스는 정상군 대비 개방 팔 체류 시간의 유의한 감소를 초래했습니다(p<0.01). 그림 2b (A-D)에서 보여지듯, 마우스에게 다양한 용량의 FBR을 투여했을 때 주목할 만한 효과가 나타났다. 구체적으로, 저용량 및 중용량 FBR은 EPMT에서 개방 팔(p<0.05) 및 중앙 구역(각각 p<0.01, p<0.05)에 머문 시간 감소 현상을 역전시켰다. 또한, 이러한 FBR 용량은 만성 스트레스로 인해 증가했던 폐쇄 팔에서의 체류 시간을 유의하게 감소시켰다(각각 p<0.01, p<0.05). 이러한 결과들은 FBR이 만성 스트레스의 불안 유발 효과를 상쇄함으로써 EPMT에서 보다 균형 잡힌 행동을 회복시켰다는 점에서, FBR의 항불안 유사 특성을 종합적으로 강조한다.
신규 물체 인식 검사(NOR)
FBR 투여는 NOR 검사에서 익숙한 물체와 새로운 물체 간의 식별률(%)을 유의미하게 향상시켰으며, 이 효과는 FBR 중·고용량에서 가장 두드러지게 나타났습니다(p<0.001). 이는 두 물체를 구분하지 못한 스트레스군(p<0.001)과 극명한 대조를 이루었습니다. 특히, 실험군 간 총 탐색 시간(초)에는 유의미한 차이가 관찰되지 않았다. 이러한 결과는 FBR 치료로 관찰된 인지 기능 개선이 전반적인 탐색 행동 변화와 동반되지 않았음을 강조한다. 그림 2c (A-C)는 FBR 투여 후 인지적 구별 능력이 증가한 결과를 보여준다. 이는 특히 중간 및 고용량으로 투여된 FBR이 스트레스 유발 인지 장애 완화에 도움이 될 수 있음을 시사하며, 이는 신물체 인식 검사 결과로 입증된다.
개방형 공간 검사
OFT는 설치류 연구에서 널리 사용되는 행동 분석법으로, 탐색 및 불안 관련 행동을 평가하는 유용한 도구 역할을 한다. 이 검사는 총 이동 거리, 중심부 대비 주변부 체류 시간 등 요소를 평가하여 설치류의 정서 상태와 신기함 추구 경향 사이의 복잡한 관계를 탐구합니다. 기능적으로 개방형 공간 검사(OFT)는 낯선 영역 탐색 경향과 불안 유발 자극에 대한 민감도를 평가함으로써 동물의 정서 상태에 대한 통찰을 제공합니다. 일반적으로 실험장 중앙부에서 더 많은 시간을 보내려는 선호도는 불안 수준이 낮음을 나타내는 지표로 간주됩니다. 중앙부는 주변부 가장자리에 비해 보호 기능이 약하기 때문입니다. 반대로 주변부를 선호하는 행동은 불안 증가를 시사합니다. 본 분석에서는 중앙부 진입 빈도에 주목했습니다. 눈에 띄게, 만성 스트레스를 받은 쥐들은 중앙 진입 횟수가 현저히 감소하여 불안 유사 행동이 증가했음을 시사했습니다. 반면, FBR 치료군은 경기장 중앙에서 보낸 시간과 이동 모두에서 현저한 증가를 보이며 뚜렷한 개선을 나타냈습니다. 이 효과는 특히 중간 용량군(p<0.05)에서 두드러졌으며, 이는 그림 2d (A-D)에 묘사되어 있습니다. 그러나 실험군 간에 총 이동 거리 대비 주변부 이동 거리 비율에서는 유의미한 차이가 관찰되지 않았다는 점이 주목할 만하다. 이는 FBR 치료가 중심부 탐색 및 운동을 증가시켰으나, 동물의 전반적인 이동 패턴에는 크게 영향을 미치지 않았음을 시사한다. 요약하면, OFT는 설치류가 환경과 상호작용하는 방식을 이해하는 데 유용한 통찰을 제공하며, 스트레스, 중재, 탐색 행동 간의 복잡한 역학을 부각시킨다. 이 결과는 특히 경기장 중심부와의 상호작용 증가를 통해 불안 반응을 조절할 수 있는 FBR의 잠재력을 강조한다.
강제 수영 검사
FST는 항우울제 효능 평가에 자주 활용되는 핵심 검사법이다. 이 패러다임에서 부동 상태 지속 시간은 스트레스 모델의 반응을 파악하는 주요 지표로 기능한다. FST에서의 부동 시간은 이 검사의 핵심 특징인 무기력함을 나타내는 행동 지표입니다. 만성 스트레스를 받은 집단은 부동 지속 시간이 유의미하게 증가했습니다(p<0.001). 이 연장된 부동 기간은 무기력 상태의 유도를 강조하며, 이 행동 결과에 대한 기존 해석과 일치합니다. 이에 비해 정상군과 FBR 처리군은 다른 반응을 보였다. 스트레스군은 정상군 및 FBR 처리군에 비해 유의하게 긴 부동 기간을 보였으며, 이는 FBR이 스트레스 유발 절망 유사 행동을 감소시키는 데 효과적임을 시사한다(p<0.05). FBR 처리는 그림 2e에서 보듯이 활동적 수영 시간을 유의하게 증가시키면서 부동 시간을 감소시켰다(p<0.05). 이러한 결과는 FBR이 무기력 시간 감소 및 활발한 수영 증가를 통해 항우울제 유사 효과를 나타냄으로써 스트레스 유발 무기력과 관련된 행동 반응을 조절할 수 있음을 시사한다. 이는 기분 향상 특성을 가진 화합물 선별에 FST의 광범위한 유용성을 뒷받침하며, FBR이 스트레스 관련 행동 변화를 완화하는 데 도움이 될 수 있음을 시사한다.
FBR이 행동 결과에 미치는 긍정적 영향을 고려하여, 만성 스트레스에 대한 FBR의 영향을 보다 포괄적으로 이해하기 위해 추가 호르몬 분석을 수행하였다. 이를 통해 FBR이 호르몬 수준에서 스트레스 반응을 조절할 수 있는지 파악함으로써, 본 연구에서 관찰된 행동적 개선을 보완할 수 있을 것이다.
Stress-induced corticosterone levels
The analysis of plasma corticosterone emerged as a critical biomarker, reflecting the complex neuroendocrine response to stress across all six experimental groups. Primarily, the results revealed a significant increase in corticosterone levels due to chronic stress (p < 0.001). This finding underscores the well-established association between stress and heightened glucocorticoid release. However, the FBR intervention effectively counteracted the stress-induced rise in corticosterone levels, significantly restoring them to baseline values. This indicates that FBR treatment plays a role in normalizing the neuroendocrine response to chronic stress. This restorative effect was clearly evident, with a marked difference between the stressed group and the FBR-treated groups, as shown in Fig. 2f (a). These findings highlight FBR’s potential in modulating the stress response, offering valuable insights into its physiological impact within this experimental context.
스트레스 유발 코르티코스테론 수치
혈장 코르티코스테론 분석은 6개 실험군 모두에서 스트레스에 대한 복잡한 신경내분비 반응을 반영하는 핵심 생체지표로 부상했습니다. 주요 결과는 만성 스트레스로 인한 코르티코스테론 수치의 유의미한 증가(p<0.001)를 보여주었습니다. 이 발견은 스트레스와 글루코코르티코이드 분비 증가 사이의 확립된 연관성을 강조합니다. 그러나 FBR 개입은 스트레스 유발 코르티코스테론 수치 상승을 효과적으로 억제하여 기준치로 유의미하게 회복시켰다. 이는 FBR 치료가 만성 스트레스에 대한 신경내분비 반응 정상화에 기여함을 시사한다. 이러한 회복 효과는 스트레스군과 FBR 치료군 간 뚜렷한 차이로 명확히 관찰되었으며, 이는 그림 2f (a)에 제시되어 있다. 이러한 결과는 FBR이 스트레스 반응 조절에 잠재력을 지니며, 본 실험적 맥락에서 그 생리적 영향에 대한 귀중한 통찰을 제공함을 부각시킨다.
Detection of neurotransmitter levels
We investigated the levels of two crucial neurotransmitters, GABA and serotonin, by analyzing blood plasma samples from all experimental groups. These neurotransmitters play key roles in regulating mood, cognition, and overall mental well-being. Importantly, the stressed group exhibited a significant decline in both GABA and serotonin levels, indicating a disruption in these essential neuromodulators due to chronic stress. However, a marked change occurred following FBR and drug interventions. The administration of FBR and fluoxetine (Flu) significantly enhanced neurotransmitter levels, with the FBR-treated groups showing the most pronounced improvements, as depicted in Fig. 2f (b, c). This restorative effect highlights FBR’s potential to counteract the neurochemical alterations induced by chronic stress. The observed increase in GABA and other neurotransmitter levels may be attributed to the GABA-producing capabilities of the strain used in this study, which was confirmed in our previous research. Both the strain and the FBR were analyzed for GABA production, along with other beneficial metabolites. These findings suggest that FBR’s impact on neurotransmitter dynamics could be a result of the strain’s ability to synthesize GABA, potentially contributing to the observed neurochemical improvements and supporting the therapeutic potential of FBR in addressing stress-related neurobiological imbalances. The findings highlight a promising avenue for further exploration into FBR’s mechanisms of action and its potential role in modulating neurotransmitter pathways.
신경전달물질 수준 검출
모든 실험군에서 채취한 혈장 샘플을 분석하여
두 가지 핵심 신경전달물질인 GABA와 세로토닌의 수준을 조사하였다.
이 신경전달물질들은
기분, 인지, 전반적인 정신 건강 조절에 핵심적인 역할을 한다.
중요한 점은 스트레스를 받은 집단에서
GABA와 세로토닌 수치가 모두 현저히 감소하여
만성 스트레스로 인해 이러한 필수 신경조절물질의 기능이 저해되었음을 나타냈습니다.
그러나 FBR 및 약물 중재 후 뚜렷한 변화가 발생했습니다. FBR과 플루옥세틴(Flu) 투여는 신경전달물질 수치를 유의미하게 향상시켰으며, FBR 처리 집단에서 가장 두드러진 개선이 관찰되었습니다(그림 2f (b, c) 참조). 이러한 회복 효과는 만성 스트레스에 의해 유발된 신경화학적 변화를 상쇄할 수 있는 FBR의 잠재력을 부각시킨다. 관찰된 GABA 및 기타 신경전달물질 수치의 증가는 본 연구에 사용된 균주의 GABA 생성 능력에 기인할 수 있으며, 이는 이전 연구에서 확인된 바 있다. 균주와 FBR 모두 GABA 생산 능력과 기타 유익한 대사산물에 대해 분석되었다. 이러한 결과는 FBR이 신경전달물질 역학에 미치는 영향이 균주의 GABA 합성 능력에서 비롯될 수 있음을 시사하며, 이는 관찰된 신경화학적 개선에 기여하고 스트레스 관련 신경생물학적 불균형 해결에 있어 FBR의 치료적 잠재력을 뒷받침할 수 있다. 본 연구 결과는 FBR의 작용 기전과 신경전달물질 경로 조절에서의 잠재적 역할에 대한 추가 탐구를 위한 유망한 방향을 제시한다.
Anti-inflammatory activities of FBR
The investigation explored the potential anti-inflammatory effects of FBR, with a focus on two key inflammatory markers: interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α). These markers are widely recognized as indicators of inflammation in various diseases and play a significant role in the immune response. Serum samples from both stressed and treatment groups were analyzed to assess the extent of inflammation. The stressed group displayed the highest levels of inflammation, evidenced by elevated IL-6 and TNF-α levels, which align with the established connection between stress and heightened inflammatory responses. In contrast, FBR and drug treatments led to a significant reduction in serum IL-6 and TNF-α levels, indicating an attenuation of the inflammatory response. These results suggest that FBR has the potential to exert anti-inflammatory effects, as illustrated in Fig. 2g. In summary, the study underscores FBR’s ability to modulate the immune response by reducing inflammation, as shown by the decrease in IL-6 and TNF-α levels (Fig. 2g). These findings support the notion that FBR may possess intrinsic anti-inflammatory properties, making it a promising candidate for conditions characterized by chronic inflammation. Further research into FBR’s mechanisms of action related to immune modulation could open new therapeutic possibilities. A clear alignment emerged after conducting a comprehensive series of assessments across behavior, hormone levels, neurotransmitter detection, and inflammatory markers. The results of FBR treatment closely mirrored those observed in the fluoxetine drug treatment groups, highlighting FBR’s potential to improve behaviors associated with stress-related disorders and enhance cognitive function. This connection is especially compelling given the well-established efficacy of pharmacological agents in treating stress-related disorders. However, prolonged use of such drugs is associated with a range of adverse effects, including dizziness, weight gain, vomiting, and headaches. Therefore, our study is based on the hypothesis that incorporating fermented foods, such as FBR, into our diet may help mitigate the potential drawbacks of drug use. This approach holds promise for promoting overall health and well-being. As demonstrated by the earlier analysis, FBR showed significant efficacy in countering chronic stress, as reflected in the reduction of anxiety-related behaviors and the enhancement of key neuromodulators. These promising findings set the stage for further research. To deepen our understanding of FBR’s therapeutic effects, we expanded our investigation to include detailed metabolomic analyses of both fecal and blood samples, as well as in-depth studies on gut metagenomics. This approach allowed us to explore the broader physiological and microbiome-related mechanisms underlying FBR’s beneficial impact.
FBR의 항염증 활성
본 연구는 FBR의 잠재적 항염증 효과를 탐구했으며,
특히 두 가지 주요 염증 지표인 인터루킨-6(IL-6)과 종양괴사인자-알파(TNF-α)에 초점을 맞췄습니다.
이 지표들은
다양한 질환에서 염증의 지표로 널리 인정되며
면역 반응에서 중요한 역할을 합니다.
염증 정도를 평가하기 위해
스트레스 그룹과 치료 그룹의 혈청 샘플을 분석했습니다.
스트레스 그룹은 IL-6 및 TNF-α 수치 상승으로 입증된 최고 수준의 염증을 보였으며,
이는 스트레스와 강화된 염증 반응 간의 확립된 연관성과 부합한다.
반면 FBR 및 약물 치료는
혈청 IL-6 및 TNF-α 수치를 현저히 감소시켜 염증 반응이 약화되었음을 나타냈다.
이러한 결과는 FBR이 항염증 효과를 발휘할 잠재력을 시사하며,
이는 그림 2g에 설명되어 있습니다.
요약하면,
본 연구는 IL-6 및 TNF-α 수치 감소(그림 2g)를 통해
FBR이 염증을 감소시켜 면역 반응을 조절하는 능력을 강조합니다.
이러한 발견은 FBR이 고유한 항염증 특성을 지닐 수 있다는 개념을 뒷받침하며,
만성 염증이 특징인 질환에 대한 유망한 후보 물질임을 시사합니다.
면역 조절과 관련된 FBR의 작용 기전에 대한 추가 연구는
새로운 치료 가능성을 열 수 있다.
행동, 호르몬 수준, 신경전달물질 검출 및 염증 표지자에 걸친 포괄적인 평가 시리즈를 수행한 후 명확한 일관성이 나타났다. FBR 치료 결과는 플루옥세틴 약물 치료군에서 관찰된 결과와 매우 유사하게 나타났으며, 이는 FBR이 스트레스 관련 장애와 연관된 행동을 개선하고 인지 기능을 향상시킬 잠재력을 지녔음을 시사합니다. 약리학적 제제가 스트레스 관련 장애 치료에 확립된 효능을 지닌다는 점을 고려할 때, 이러한 연관성은 특히 설득력 있습니다. 그러나 이러한 약물의 장기 사용은 현기증, 체중 증가, 구토, 두통 등 다양한 부작용과 연관되어 있습니다. 따라서 본 연구는 FBR과 같은 발효 식품을 식단에 포함시키는 것이 약물 사용의 잠재적 단점을 완화하는 데 도움이 될 수 있다는 가설에 기반합니다. 이 접근법은 전반적인 건강과 웰빙 증진에 유망합니다. 앞서 분석에서 입증된 바와 같이, FBR은 불안 관련 행동 감소와 주요 신경조절물질 증진으로 나타난 만성 스트레스 대응에 상당한 효능을 보였습니다. 이러한 유망한 결과는 추가 연구의 토대를 마련합니다. FBR의 치료 효과를 심층적으로 이해하기 위해, 우리는 연구 범위를 확대하여 대변 및 혈액 샘플에 대한 상세한 대사체 분석과 장내 미생물군집에 대한 심층 연구를 포함시켰습니다. 이러한 접근을 통해 FBR의 유익한 영향에 기초하는 광범위한 생리학적 및 미생물군집 관련 메커니즘을 탐구할 수 있었습니다.
Effect of psychobiotics FBR administration on SCFAs
SCFAs play a key role in the gut-brain axis and are recognized as beneficial metabolites37. They enhance immune system function by promoting cytokine secretion and aiding T-cell differentiation. Additionally, SCFAs protect the integrity of both the intestinal and blood-brain barriers, reducing permeability. They also regulate the HPA axis through vagus nerve signaling38. We analyzed the levels of acetate, propionate, and butyrate in fecal samples. Chronic stress significantly reduced acetic and propionic acid concentrations. Acetic acid, a primary metabolic byproduct of LAB, is known to enhance intestinal epithelial barrier function, supporting gut health and integrity39,40. However, oral administration of FBR notably increased the production of these SCFAs, with butyrate levels surpassing baseline values. Particularly, low and medium doses effectively prevented the reduction of SCFAs in the mouse gut (Fig. 3). The enhancement in acetic and propionic acid levels following FBR interventions highlights the beneficial role of dietary fibers in promoting gut health. Butyrate serves as a key energy source for colonocytes and plays an essential role in maintaining gut homeostasis and restoring barrier integrity during stress41. Its anti-inflammatory and energy-providing properties likely make it a priority metabolite under stress conditions, explaining its continued presence even as other SCFAs were diminished. Chronic stress often induces gut dysbiosis, leading to an imbalance in microbial communities. This disruption typically includes a reduction in beneficial bacterial groups that are key producers of SCFAs, such as acetate, propionate, and butyrate. The depletion of these microbes can significantly lower overall SCFA production. However, if butyrate-producing bacteria remain active, butyrate may still be detectable despite the overall decline in SCFAs. These findings highlight the critical role of SCFAs in maintaining gut homeostasis during stress, demonstrating their resilience under adverse conditions. To further investigate the relationship between gut microbiota, and the gut-brain axis, additional gut metagenomics were conducted to elucidate the microbial pathways involved in SCFA production and their broader systemic effects42,43.
심리생물제 FBR 투여가 SCFAs에 미치는 영향
단쇄지방산(SCFAs)은
장-뇌 축에서 핵심 역할을 하며 유익한 대사산물로 인정받고 있습니다37.
사이토카인 분비를 촉진하고
T세포 분화를 지원함으로써 면역 체계 기능을 강화합니다.
또한 SCFAs는
장 및 혈액-뇌 장벽의 무결성을 보호하여 투과성을 감소시킵니다.
미주신경 신호를 통해 HPA 축을 조절하기도 합니다38.
우리는 대변 샘플에서
아세테이트, 프로피오네이트, 부티레이트의 농도를 분석했습니다.
만성 스트레스는
아세트산과 프로피온산 농도를 현저히 감소시켰다.
유산균(LAB)의 주요 대사 부산물인 아세트산은
장 상피 장벽 기능을 강화하여 장 건강과 무결성을 지원하는 것으로 알려져 있다39,40.
그러나 FBR 경구 투여는 이러한 SCFA 생성을 현저히 증가시켰으며, 부티레이트 수치는 기준값을 초과했다. 특히 저용량 및 중간 용량은 생쥐 장내 SCFA 감소 현상을 효과적으로 방지했다(그림 3). FBR 개입 후 아세트산 및 프로피온산 수치의 증가는 장 건강 증진에 있어 식이섬유의 유익한 역할을 강조한다. 부티레이트는 대장 상피세포의 주요 에너지원으로 작용하며, 스트레스 상황에서 장 항상성 유지 및 장벽 무결성 회복에 필수적인 역할을 한다41. 그 항염증 및 에너지 공급 특성은 스트레스 조건 하에서 우선적 대사산물로 작용하게 하여, 다른 SCFA가 감소하는 상황에서도 지속적으로 존재하는 이유를 설명한다.
만성 스트레스는
종종 장내 미생물군집 불균형(dysbiosis)을 유발하여 미생물 군집의 불균형을 초래한다.
이러한 교란은
일반적으로 아세트산, 프로피온산, 부티레이트와 같은 SCFA의 주요 생산자인
유익한 박테리아 군집의 감소를 포함한다.
이러한 미생물의 고갈은 전체 SCFA 생산량을 현저히 낮출 수 있다.
그러나 부티레이트 생성 박테리아가 활성 상태를 유지한다면, SCFA의 전반적 감소에도 불구하고 부티레이트는 여전히 검출될 수 있다. 이러한 결과는 스트레스 상황에서 장 내 항상성 유지에 SCFA가 수행하는 핵심적 역할을 부각시키며, 불리한 조건에서도 SCFA가 회복력을 보임을 입증한다. 장내 미생물군과 장-뇌 축 간의 관계를 추가로 규명하기 위해, SCFA 생산에 관여하는 미생물 경로와 그 광범위한 전신적 효과를 밝히기 위한 추가적인 장내 메타게놈 분석이 수행되었다42,43.
Fig. 3: Short-chain fatty acids (SCFAs) levels were measured in fecal samples across groups.
The data represent the means ± S.E.M. (n = 7 per group). Normal & treatment versus the stress-only group. Alphabets b–k represent significant differences, where a represents the SCFAs absent in the stressed group. Normal: normal or No stress, Stressed only group: Stress, FBR Fermented brown rice, Drug (Flu) Fluoxetine, LD Low dose, MD Medium dose, HD High dose.
Psychobiotics FBR administration modulated the altered gut microbiota composition of chronically stressed mice
The gut microbiome influences brain function through the gut-brain axis. Chronic stress induces significant changes in gut microbiota composition, often leading to dysbiosis, an imbalance characterized by a reduction in beneficial bacteria and an enhancement of pathogenic microbes. This dysbiosis can exacerbate gut permeability, inflammation, and metabolic dysfunction, further influencing the gut-brain axis and contributing to stress-related disorders. Moreover, alterations in microbiota-derived metabolites, such as SCFAs, can modulate the immune response and neuroinflammation, highlighting the complex interaction between the gut microbiome and stress physiology. In the present research, mice subjected to chronic restraint stress were found to have altered gut microbiota compositions compared to normal/control mice44. Consequently, a 16S rRNA (V3–V4) sequencing analysis was performed to examine the diversity of the gut microbiota in mice subjected to chronic stress. The study focused on the gut microbial composition two weeks after stress induction. Particularly, during the early stages of chronic stress, the relative abundance of the Firmicutes phylum significantly decreased (40.46%) compared to the normal group (67.10%). In contrast, the Bacteroidetes phylum showed a marked increase in stressed mice (52.25%) compared to normal (32.66%). Additionally, the Proteobacteria phylum, which was undetected in the normal group (0.0%), was significantly elevated in the stressed group (6.55%). In all analyses conducted thus far, superior efficacy has been observed at low and medium doses of FBR compared to the high dose (1000 mg/kg body weight). As per our understanding, this may be explained by differences in bioavailability and metabolic dynamics. At higher doses, the semi-solid consistency of FBR likely hinders proper dissolution, reducing the absorption of bioactive compounds. This aligns with established pharmacodynamic principles, where intermediate doses often yield optimal effects because excessive doses can saturate biological pathways, leading to diminishing or no additional benefits. Moreover, high doses, such as 1000 mg/kg, may induce metabolic overload or minor adverse effects on metabolic systems, which could counteract therapeutic benefits. At moderate doses, such as 500 mg/kg, bioactive compounds are absorbed and utilized more efficiently, avoiding the metabolic competition and reduced bioavailability seen at higher doses. These findings emphasize the importance of dose optimization in preclinical research, underscoring the need to balance efficacy and safety when establishing appropriate dosages for therapeutic interventions. As low and medium doses of FBR demonstrated superior efficacy in behavioral, corticosterone hormone, neurotransmitter (GABA and serotonin), and inflammatory analyses, further study was conducted to examine the impact of these doses on gut microbiota modulation. At the phylum level, Bacteroidetes, Firmicutes, Proteobacteria, and Tenericutes were the predominant bacterial groups across all seven experimental groups. In the normal group, the relative abundances of Bacteroidetes, Firmicutes, and Proteobacteria were 64.93%, 32.30%, and 1.11%, respectively. In contrast, chronic stress resulted in an increase in Proteobacteria (42.21%) and a decrease in Bacteroidetes (42.78%) and Firmicutes (13.88%) at the phylum level. In particular, FBR intervention of all three doses reduced the relative abundance of Proteobacteria (1.18%) to levels comparable to the normal group. Furthermore, the low and medium doses of FBR increased the abundance of Bacteroidetes (62.67% and 51.18%) and Firmicutes (34.08% and 40.1%) at the phylum level. Importantly, the analysis revealed that the low and medium doses of FBR were more effective in modulating the gut microbiota at the phylum level compared to the higher dose. However, in the group treated with the drug, the abundance of Proteobacteria (6.08%) was significantly higher than in the normal group, accompanied by an increase in Bacteroidetes (76.94%) and a decrease in Firmicutes (14.11%) (Fig. 4A). Mainly, FBR treatment resulted in an increase in the Firmicutes/Bacteroidetes ratio compared to the stressed group. Our findings suggest that Proteobacteria may serve as a microbial signature of dysbiosis in the chronic stress model. These findings are consistent with recent studies45,46, which similarly identified Proteobacteria as a signature of dysbiosis.
장내 미생물군집은
장-뇌 축을 통해 뇌 기능에 영향을 미칩니다.
만성 스트레스는
장내 미생물군집 구성에 상당한 변화를 유발하며,
이는 종종 유익균 감소와 병원성 미생물 증가로 특징지어지는
불균형인 장내 미생물군집 불균형(dysbiosis)으로 이어집니다.
이러한 불균형은
장 투과성, 염증 및 대사 기능 장애를 악화시켜 장-뇌 축에 추가적인 영향을 미치고
스트레스 관련 장애에 기여할 수 있다.
또한
SCFA(단쇄 지방산)와 같은 미생물군집 유래 대사물질의 변화는
면역 반응과 신경염증을 조절할 수 있어,
장내 미생물군집과 스트레스 생리학 간의 복잡한 상호작용을 부각시킨다.
본 연구에서 만성 구속 스트레스를 받은 쥐는 정상/대조군 쥐에 비해 장내 미생물군 구성에 변화가 있는 것으로 확인되었다44. 이에 따라 만성 스트레스를 받은 쥐의 장내 미생물군 다양성을 조사하기 위해 16S rRNA (V3–V4) 시퀀싱 분석을 수행하였다. 본 연구는 스트레스 유발 2주 후의 장내 미생물군 구성에 초점을 맞추었다. 특히 만성 스트레스 초기 단계에서 Firmicutes 문(門)의 상대적 풍부도는 정상군(67.10%) 대비 현저히 감소한 40.46%를 기록했다. 반면 Bacteroidetes 문은 스트레스 마우스군(52.25%)에서 정상군(32.66%) 대비 뚜렷한 증가세를 보였다. 또한 정상군에서는 검출되지 않았던 프로테오박테리아문(0.0%)이 스트레스군에서는 유의미하게 증가했다(6.55%). 지금까지 수행된 모든 분석에서 FBR의 저·중용량은 고용량(1000mg/kg 체중)에 비해 우수한 효능을 보였다. 우리의 이해에 따르면, 이는 생체이용률과 대사 역학의 차이로 설명될 수 있다. 고용량에서는 FBR의 반고체 상태가 적절한 용해를 방해하여 생리활성 화합물의 흡수를 저해할 가능성이 있습니다. 이는 과도한 용량이 생물학적 경로를 포화시켜 추가적 이점이 감소하거나 사라질 수 있다는 확립된 약력학적 원리와 부합합니다. 또한 1000mg/kg과 같은 고용량은 대사 과부하나 대사 시스템에 대한 경미한 부작용을 유발하여 치료적 이점을 상쇄할 수 있습니다. 500mg/kg과 같은 중간 용량에서는 생리활성 물질이 더 효율적으로 흡수 및 활용되어 고용량에서 나타나는 대사적 경쟁과 생체이용률 저하를 피할 수 있습니다. 이러한 결과는 치료적 개입을 위한 적절한 용량 설정 시 효능과 안전성의 균형을 유지해야 함을 강조하며, 전임상 연구에서 용량 최적화의 중요성을 부각시킵니다. FBR의 저용량 및 중간 용량이 행동 분석, 코르티코스테론 호르몬, 신경전달물질(GABA 및 세로토닌), 염증 분석에서 우수한 효능을 보였으므로, 이러한 용량이 장내 미생물군 조절에 미치는 영향을 조사하기 위한 추가 연구가 수행되었다. 문(門) 수준에서 박테로이데테스(Bacteroidetes), 퍼미큐테스(Firmicutes), 프로테오박테리아(Proteobacteria), 테네리큐테스(Tenericutes)는 7개 실험군 전체에서 우점하는 세균군이었다. 정상군에서 박테로이데테스, 퍼미큐테스, 프로테오박테리아의 상대적 풍부도는 각각 64.93%, 32.30%, 1.11%였다. 반면 만성 스트레스는 문 수준에서 프로테오박테리아(42.21%)의 증가와 박테로이데테스(42.78%) 및 퍼미쿠테스(13.88%)의 감소를 초래했다. 특히 세 가지 용량의 FBR 투여는 프로테오박테리아의 상대적 풍부도(1.18%)를 정상군과 유사한 수준으로 감소시켰다. 또한 FBR의 저용량 및 중용량은 문 수준에서 박테로이데테스(62.67% 및 51.18%)와 퍼미큐테스(34.08% 및 40.1%)의 풍부도를 증가시켰다. 중요한 점은 분석 결과 FBR의 저용량 및 중용량이 고용량에 비해 문 수준에서 장내 미생물군집 조절에 더 효과적임을 보여주었다. 그러나 약물 처리군에서는 프로테오박테리아(6.08%)의 풍부도가 정상군보다 유의하게 높았으며, 박테로이데테스(76.94%)는 증가하고 퍼미큐테스(14.11%)는 감소하는 현상이 동반되었다(그림 4A). 주로 FBR 처리는 스트레스군에 비해 퍼미큐테스/박테로이데테스 비율을 증가시켰다. 본 연구 결과는 만성 스트레스 모델에서 프로테오박테리아가 미생물 불균형의 지표 역할을 할 수 있음을 시사한다. 이러한 결과는 최근 연구들45,46에서도 프로테오박테리아를 불균형의 지표로 동일하게 확인한 것과 일치한다.
Fig. 4: This figure represents gut microbiota composition, heat map, and correlation analysis across study groups.
A represents Phylum level composition of gut microbiota in different groups, B shows Genus level composition of Proteobacteria in different groups, C is Heat map of gut microbiota composition in different groups at the species level (D). Heatmap of spearman’s correlation between gut microbiota, SCFA’s, and chronic stress-related physiological traits. Normal normal or No stress, FBR Fermented brown rice, Drug (Flu) Fluoxetine, LD Low dose, MD Medium dose, HD High dose.
A volcano plot was generated to differentiate the vital bacterial groups among the normal, Stressed, and treatment groups. The plot utilized log fold change and false discovery rate (FDR) values, employing a predetermined cut-off value of 2 (p < 0.05) to identify significant changes. FDR (p < 0.05) was employed to select genera that exhibited significant alterations due to chronic stress (Fig. 5). Chronic stress led to dysbiosis in the gut microbiota, marked by a prominent increase in the relative abundance of pathogenic bacterial genera such as Acinetobacter, Proteus, Enterococcus, Prevotella, Mammalicoccus, Lactococcus, Peptococcus, Canobacterium, Aerococcus, and Bacillus. Conversely, certain genera, including Muribaculum, Culturomica, Kinothrix, Roseburia, Duncaniella, Phocaeicola, Limosilactobacillus, Alistipes, Hungatella, Flinibacter, Oscillibacter, and Phocea, exhibited decreased abundance (Fig. 4A–C).
Fig. 5: Volcano plot of bacterial variation across groups.
The volcano plot displays the variation in bacterial prevalence among control, Stressed, FBR-treated, and Drug (FLU) treatment groups. Where red dots indicate upregulations, green represents downregulation, and black represents No significant difference. A value greater than 2 on the y axis indicates statistically significant differences between the groups at a significance level of p < 0.05. Normal normal or No stress, FBR Fermented brown rice, D drug (Fluoxetine), N Normal, S Stress.
At the same time, FBR treatment reversed the alterations in 10 genera induced by chronic stress. This reversal included a reduction in the abundance of opportunistic pathogens such as Acinetobacter, Enterococcus, Mammalicoccus, Lactococcus, Peptococcus, Canobacterium, Aerococcus, and Bacillus, along with an increase in the abundance of beneficial genera like Muribaculum, Phocaeicola, Alistipes, Kinothrix, Lactobacillus, Duncaniella, Christensenella, and Culturomica. Spearman correlation analysis was performed to explore the relationships between gut microbiota, SCFAs, and physiological traits associated with chronic stress (Fig. 4D). FBR’s impact on genera such as Muribaculum, Phocaeicola, Alistipes, Kinothrix, Lactobacillus, Duncaniella, Christensenella, and Culturomica demonstrated positive correlations with SCFAs and neurotransmitters (GABA and serotonin). In contrast, genera enriched by chronic stress, including Acinetobacter, Proteus, Enterococcus, Prevotella, Mammalicoccus, Lactococcus, Peptococcus, Cyanobacterium, Aerococcus, and Bacillus, showed positive correlations with the stress hormone corticosterone and inflammatory markers (IL-6 and TNF-α), while negatively correlating with SCFAs and neurotransmitters. This analysis highlights the beneficial effects of FBR intervention in modulating the gut microbiota and enhancing health-promoting biomarkers, ultimately mitigating the detrimental impact of chronic stress.
동시에 FBR 처리는 만성 스트레스로 인한 10개 속의 변화를 역전시켰습니다. 이러한 역전에는 아시네토박터, 엔테로코커스, 마말리코커스, 락토코커스, 펩토코커스, 카노박테리움, 에어로코커스, 바실러스와 같은 기회적 병원균의 풍부도 감소와 함께, 무리박큘럼, 포카에콜라, 알리스티페스, 키노트릭스, 락토바실러스, 던카니엘라, 크리스텐세넬라, 컬투로미카와 같은 유익한 속의 풍부도 증가가 포함되었습니다. 만성 스트레스와 관련된 장내 미생물군집, 단쇄지방산(SCFAs), 생리적 특성 간의 관계를 탐색하기 위해 스피어먼 상관 분석을 수행하였다(그림 4D).
FBR이
Muribaculum, Phocaeicola, Alistipes, Kinothrix, Lactobacillus, Duncaniella, Christensenella, Culturomica 등의
속(屬)에 미치는 영향은
단쇄지방산(SCFAs) 및 신경전달물질(가바(GABA)와 세로토닌)과 양의 상관관계를 보였다.
반면,
만성 스트레스로 풍부해진
아시네토박터(Acinetobacter), 프로테우스(Proteus), 엔테로코커스(Enterococcus), 프레보텔라(Prevotella),
마말리코커스(Mammalicoccus), 락토코커스(Lactococcus), 펩토코커스(Peptococcus),
시아노박테리움(Cyanobacterium), 에어로코커스(Aerococcus), 바실러스(Bacillus) 속은
스트레스 호르몬인 코르티코스테론과 염증 표지자(IL-6 및 TNF-α)와 양의 상관관계를 보인 반면,
SCFA 및 신경전달물질과는 음의 상관관계를 보였다.
이 분석은 장내 미생물군을 조절하고 건강 증진 바이오마커를 향상시켜 궁극적으로 만성 스트레스의 해로운 영향을 완화하는 FBR 개입의 유익한 효과를 강조한다.
Effect of psychobiotics FBR administration on serum and gut metabolomics
Serum and gut metabolomics provide valuable insights into the biochemical alterations associated with chronic stress. To further investigate the chronic stress-related biomarkers influenced by the gut microbiota, serum metabolomics analysis was performed. This analysis identified various metabolites, including amino acids (AAs) and their derivatives, fatty acids, and organic acids. The stressed group primarily exhibited an enrichment of metabolites associated with glucose metabolism. In contrast, FBR treatment resulted in the enrichment of several amino acids, fatty acids, and their derivatives, including tryptophan, phenylalanine, ornithine, histidine, linoleic acid, palmitic acid, isostearic acid, 3-hydroxyproline, docosapentaenoic acid, 11-eicosatrienoic acid, and arachidonic acid. Compared to the drug-treated group, the FBR-treated group displayed specific amino acids, such as lysine, threonine, citric acid, oleic acid, tyrosine, pyroglutamic acid, glutamine, and selected fatty acids. Our metabolomics findings are consistent with previous research, which highlights a significant increase in glucose metabolism during chronic stress. This alignment underscores the relationship between metabolic alterations and the physiological response to prolonged stress. Studies have shown that in response to chronic stressors, the body activates a range of adaptive mechanisms, including enhanced glucose metabolism. This process is closely tied to the “fight or flight” response, an evolutionary survival mechanism that prepares the body to confront challenges. During stress, various physiological processes are coordinated to ensure a rapid and efficient energy supply, crucial for coping with potential threats47,48. The metabolic shift toward increased glucose utilization represents a critical adaptive mechanism during periods of stress, providing a rapid and readily available energy source to meet the heightened physiological demands. Glucose, a fundamental energy source, is rapidly converted into usable energy to meet heightened physical and cognitive demands. This surge in glucose metabolism is facilitated by complex interactions involving hormones such as cortisol and various signaling pathways. Our study highlights a correlation between stress-induced gut microbiota dysbiosis and the elevation of glucose-related metabolites, offering deeper insights into the intricate relationship between stress, metabolism, and microbial dynamics. These findings enhance our understanding of the interconnected processes underlying chronic stress and their multifaceted impact on metabolic pathways. To identify significant differences in metabolites among the normal, stressed, FBR-treated, and drug-treated groups, log fold change and FDR analyses were conducted with a threshold of 2 (p < 0.05), as depicted in Fig. 6. FBR treatment significantly elevated various microbial metabolites, closely aligning with the metabolic profile of the normal control group. In contrast, the stressed group exhibited increased levels of organic acids, lipid compounds, cortisol derivatives, and glucose-related metabolites, including hippuric acid, xanthurenic acid, tetrahydrocortisol, 2-ketobutyric acid, prostaglandin H2, gluconic acid, and glycolic acid. The FBR-treated group showed enrichment in phenolic compounds, amino acids, neuroactive compounds, and fatty acids, such as ferulic acid, p-cresol, daidzein, histidine, myristic acid, tryptophan, kynurenic acid, taurine, tyrosol, naringenin, and cinnamic acid. Heat map analysis provided a comprehensive overview of metabolites in both serum and fecal samples (Fig. 7A, B). The metabolites enriched by FBR treatment are well-recognized for their beneficial health effects. To gain a comprehensive understanding of the roles of these metabolites and their associated pathways, KEGG-enriched pathway analysis was performed (Supplementary Fig. 2). The analysis revealed that metabolites enriched in the stress group were primarily associated with disease-related pathways. In contrast, the FBR treatment group showed significant enrichment in pathways related to amino acids, fatty acids, secondary metabolites, alkaloids, the tricarboxylic acid cycle, and glutathione metabolism. These findings highlight the positive impact of FBR intervention on both gut and serum metabolomic profiles.
심리생물제제 FBR 투여가 혈청 및 장내 대사체학에 미치는 영향
혈청 및 장내 대사체학은
만성 스트레스와 관련된 생화학적 변화를 이해하는 데 중요한 통찰력을 제공한다.
장내 미생물이 영향을 미치는
만성 스트레스 관련 바이오마커를 추가로 조사하기 위해
혈청 대사체학 분석을 수행했다.
이 분석을 통해
아미노산(AA) 및 그 유도체, 지방산, 유기산을 포함한
다양한 대사산물이 확인되었다.
스트레스 그룹은
주로 포도당 대사와 관련된 대사산물의 농축을 보였다.
반면, FBR 처리는
트립토판, 페닐알라닌, 오르니틴, 히스티딘, 리놀레산, 팔미틴산, 이소스테아린산, 3-하이드록시프롤린,
도코사펜타엔산, 11-에이코사트라이엔산, 아라키돈산 등
여러 아미노산, 지방산 및 그 유도체의 농도 증가를 초래했습니다.
약물 처리군과 비교했을 때,
FBR 처리군은
라이신, 트레오닌, 시트르산, 올레산, 티로신, 피로글루탐산, 글루타민 및 특정 지방산과 같은
특정 아미노산을 나타냈다.
우리의 대사체학 연구 결과는
만성 스트레스 동안 포도당 대사가 현저히 증가한다는 점을 강조한 기존 연구와 일치한다.
이러한 일치는
대사 변화와 장기적인 스트레스에 대한 생리적 반응 간의 관계를 부각시킨다.
연구에 따르면 만성 스트레스 요인에 대응하여 신체는
강화된 포도당 대사를 포함한 다양한 적응 기전을 활성화한다.
이 과정은
진화적 생존 기전인 '투쟁 또는 도피 반응'과 밀접하게 연관되어 있으며,
이는 신체가 도전에 맞설 준비를 하게 한다.
스트레스 상태에서는 잠재적 위협에 대처하는 데 필수적인 신속하고 효율적인 에너지 공급을 보장하기 위해 다양한 생리적 과정이 협응력을 발휘한다47,48. 스트레스 기간 동안 증가된 포도당 이용으로의 대사 전환은 높아진 생리적 요구를 충족시키기 위한 신속하고 즉시 이용 가능한 에너지원을 제공하는 중요한 적응 메커니즘이다. 기본적인 에너지원인 포도당은 신체적·인지적 요구 증가에 대응하기 위해 사용 가능한 에너지로 신속히 전환된다. 이러한 포도당 대사 급증은 코르티솔과 같은 호르몬 및 다양한 신호 전달 경로의 복잡한 상호작용에 의해 촉진된다. 본 연구는 스트레스 유발 장내 미생물군집 불균형과 포도당 관련 대사산물 증가 간의 상관관계를 밝혀내어, 스트레스·대사·미생물 역학 간의 복잡한 연관성에 대한 심층적 통찰을 제공한다. 이러한 발견은 만성 스트레스의 기반이 되는 상호 연결된 과정들과 대사 경로에 미치는 다각적 영향에 대한 이해를 증진시킨다. 정상군, 스트레스군, FBR 처리군, 약물 처리군 간 대사체 유의차 식별을 위해 로그 배율 변화(log fold change) 및 FDR 분석을 수행하였으며, p値 0.05 미만(p<0.05)을 유의기준으로 설정하였습니다(그림 6 참조). FBR 처리는 정상 대조군의 대사 프로필과 유사하게 다양한 미생물 대사체를 유의하게 증가시켰습니다. 반면 스트레스 군은 히푸르산, 잔투렌산, 테트라하이드로코르티솔, 2-케토부티르산, 프로스타글란딘 H2, 글루콘산, 글리콜산 등 유기산, 지질 화합물, 코르티솔 유도체 및 포도당 관련 대사산물의 증가된 수준을 나타냈다. FBR 처리군은 페룰산, p-크레졸, 다이제인, 히스티딘, 미리스틴산, 트립토판, 키누레닉산, 타우린, 티로솔, 나린게닌, 신남산과 같은 페놀 화합물, 아미노산, 신경활성 화합물 및 지방산의 농축을 보였다. 히트맵 분석을 통해 혈청 및 분변 샘플 내 대사산물의 종합적 개요를 확인할 수 있었다(그림 7A, B). FBR 처리에 의해 풍부해진 대사산물들은 건강에 유익한 효과로 잘 알려져 있다. 이들 대사산물과 관련 경로의 역할을 포괄적으로 이해하기 위해 KEGG 풍부화 경로 분석을 수행하였다(보충 그림 2). 분석 결과 스트레스 그룹에서 풍부해진 대사산물은 주로 질병 관련 경로와 연관된 것으로 나타났다. 반면 FBR 치료 그룹은 아미노산, 지방산, 2차 대사산물, 알칼로이드, 트리카르복실산 회로, 글루타티온 대사와 관련된 경로에서 유의미한 풍부화를 보였다. 이러한 결과는 FBR 개입이 장 및 혈청 대사체 프로파일 모두에 긍정적인 영향을 미쳤음을 강조한다.
Fig. 6: Volcano plot of metabolites variation across groups.
The volcano plot displays the variation in blood metabolite prevalence among control, Stressed, FBR-treated and Drug (FLU) treatment groups. Where red dots indicate up-regulations, green represents down-regulation, and black represents No significant difference. A value >2 on the y axis indicates statistically significant differences between the groups at a significance level of p < 0.05. Normal normal or No stress, FBR fermented brown rice, D drug (Fluoxetine), N Normal, S Stress.
Fig. 7: Heat map of metabolites composition in different groups.
A fecal metabolites, B Blood metabolites. Normal normal or No stress, FBR Fermented brown rice.
Spearman’s correlation analysis was conducted to examine the relationships between key differential bacterial genera, metabolites associated with chronic stress, and biomarkers such as stress hormones, IL-6, and SCFAs. Evidently, FBR-enriched bacterial genera showed inverse correlations with metabolites positively linked to chronic stress (Fig. 8). Additionally, these genera exhibited positive correlations with treatment-enriched metabolites associated with health-promoting pathways, as identified through KEGG enrichment analysis. In contrast, bacterial genera enriched under stress conditions demonstrated inverse correlations with metabolites generated by the normal or FBR-treated groups.
Fig. 8: Heatmap of Spearman’s correlation among gut microbiota, metabolites, and stress-related traits.
Spearman’s correlation analysis was conducted to examine the relationships between key differential bacterial genera and metabolites associated with chronic stress and treatment groups.
Network pharmacology analysis of FBR metabolites to understand its anti-neurodegenerative efficacy
This study investigated the potential pharmacological properties of ten significantly enriched compounds identified in FBR. These compounds were rigorously screened based on their molecular characteristics, with a focus on those demonstrating oral bioavailability values of 30% or higher and drug-likeness values exceeding 0.18 (as presented in Supplementary Table 1). The chemical constituents of FBR, along with their corresponding canonical SMILES representations, are thoroughly detailed in Supplementary Table 2. The principal objective of this study was to unravel the intricate interactions between these compounds and target genes linked to neurodegenerative diseases.
To advance this investigation, a network pharmacology analysis was conducted with precision. A Venn diagram was utilized to compare 94 target genes with the compounds of FBR, curated from the TCMSP, DisGeNET, and GeneCards databases (Supplementary Fig. 3 and Supplementary Table 3). The interactions between the ten FBR compounds and their respective target genes were visualized using Cytoscape 3.8.0 software. This analysis generated an intricate network consisting of 218 nodes and 300 edges. In this network, blue square nodes represented the ten FBR components, while red box nodes highlighted five key hub genes implicated in neurodegenerative pathways. Additionally, green circular nodes corresponded to 208 genes associated with neurodegenerative diseases, intrinsically linked to the target genes influenced by FBR compounds as illustrated in Fig. 9.
Fig. 9: Network interaction analysis of fermented brown rice (FBR) ingredients-target proteins involved in interaction networks.
The blue nodes represent the 10 chemical components, and the green circle nodes represent the 208 genes of neurodegenerative disease which correspond to the ingredients’ target-related genes. (The analysis ingredients-target network included 218 nodes and 300 edges).
The analysis highlighted the significance of the top ten components: quercetin, GABA, glutamic acid, phenylalanine, p-coumaric acid, tyrosine, cinnamic acid, tryptophan, ascorbic acid, and ferulic acid. These compounds demonstrated notable affinities for multiple target proteins through their complex interactions. Detailed examination of the interaction network identified five compounds as promising candidates for addressing neurodegenerative disorders. Among them, quercetin emerged as a stand out with 152 interactions, followed by GABA and glutamic acid, each with 49 interactions. Phenylalanine exhibited 25 interactions, and ferulic acid demonstrated 16 interactions, underscoring their potential therapeutic relevance.
To gain deeper insights into the associated pathways, a detailed protein-protein interaction (PPI) network was precisely constructed, complemented by an extensive KEGG pathway analysis, as depicted in Supplementary Figs. 3–5. These figures effectively illustrate the intricate interactions and pathways associated with the identified target genes. In summary, this study thoroughly investigated the dynamic interplay between the bioactive compounds in FBR and the target genes associated with neurodegenerative diseases. The findings suggest that specific components such as quercetin, GABA, glutamic acid, phenylalanine, and ferulic acid hold significant therapeutic potential for neurodegenerative disorders, primarily due to their capacity to interact with multiple target proteins effectively.
Gene expression analysis revealed low expression of GABA receptors in the prefrontal cortex of stressed mice
Research has highlighted that the balance of GABAergic signaling through the GABAAα2 and GABAB1β receptors in the prefrontal cortex plays a critical role in regulating anxiety, cognitive processes, and mood. Dysfunction in these receptors has been linked to various stress-related behavioral changes, including anxiety and impaired cognition49,50,51. Specifically, alterations in GABAergic signaling through GABAAα2 and GABAB1β receptors can disrupt neuronal inhibitory control, leading to heightened anxiety and cognitive deficits often observed in stress-induced models. As such, these receptors are considered promising targets for therapeutic interventions aimed at alleviating stress-related disorders and enhancing cognitive function.
To explore the potential effects of chronic stress and FBR intervention on these receptors, we collected brain samples and prefrontal cortex of mice from all experimental groups. The objective was to evaluate the expression levels of GABAAα2 and GABAB1β receptors in the prefrontal cortex to determine if chronic stress has a significant impact on their modulation. Additionally, we sought to assess whether the FBR regimen could restore the altered levels of these receptors, potentially normalizing the GABAergic signaling pathways affected by chronic stress. The impact of chronic stress on the expression of GABAAα2 and GABAB1β receptors in the prefrontal cortex of mice was profound, showing a significant reduction compared to the normal group (p < 0.05), as shown in Fig. 10. Specifically, the stress-induced group treated with the vehicle exhibited this reduction in receptor expression, highlighting the detrimental effects of chronic stress on these critical receptors. This observation underscores the dysregulation of GABAergic signaling in the brain under stress conditions, which may contribute to the anxiety and cognitive dysfunction commonly associated with chronic stress. A compelling and promising reversal was observed following the introduction of the FBR intervention. Specifically, the expression of both GABAAα2 and GABAB1β receptors showed a remarkable and statistically significant increase (p < 0.05) when compared to both the stress/vehicle group and the normal/non-stressed group, as illustrated in Fig. 10. This indicates the beneficial impact of FBR on GABAergic signaling and overall health. The gene expression findings align with our previous research, which demonstrated the potential of Limosilactobacillus reuteri as a psychobiotic strain24. Our comprehensive whole-genome analysis revealed the presence of GABA-producing gad genes in this strain, indicating its capacity to enhance GABA synthesis. This comprehensive analysis not only illustrates the complex relationship between chronic stress and receptor expression but also emphasizes the potential of FBR intervention. The ability of FBR to effectively restore and enhance the expression of GABA receptors marks a significant advancement in the promotion of mental well-being. Furthermore, the validation of our selected bacterial strain’s psychobiotic properties, coupled with its capacity to produce GABA, presents a promising avenue for the development of GABA-enriched food products through fermentation. This approach offers a tangible strategy for improving both physical and psychological health, demonstrating the potential of functional foods in addressing stress-related disorders30.
Fig. 10: Prefrontal cortex and jejunum gene expression of gamma-aminobutyric acid (GABA) receptor expression.
A GABAAα2 receptor expression in the prefrontal cortex (fold change) in the validation experiment. B GABAB1β receptor expression in the prefrontal cortex (fold change) in the validation experiment. The data represent the means ± S.E.M. (n = 7 per group). *p < 0.05, **p < 0.01,***p < 0.001, ****p < 0.0001 versus the stress-only group. Normal normal or No stress, FBR Fermented brown rice, Drug (Flu) Fluoxetine, LD Low dose, MD Medium dose, HD High dose.
Our study demonstrates that Limosilactobacillus reuteri FBR significantly alleviates anxiety-related behaviors and cognitive impairments in a chronic mild stress (CMS) model using ICR mice. The four-week FBR regimen reversed behavioral despair, reduced corticosterone levels, and improved neurotransmitter balance, specifically GABA and serotonin. Metagenomic analysis of fecal samples and serum metabolomics profiling further revealed that FBR treatment enhances amino acid and energy metabolism, as well as SCFAs. The FBR-treated group exhibited a gut microbiome composition more closely resembling that of the normal group, indicating a beneficial modulation of the gut microbiota. Key bacterial species such as Muribaculum, Phocaeicola, Alistipes, and Lactobacillus were enriched, while the abundance of opportunistic pathogens like Acinetobacter, Proteus, Enterococcus, Prevotella, Mammalicoccus, Lactococcus, Peptococcus, Canobacterium, Aerococcus, and Bacillus was decreased. Additionally, FBR consumption led to favorable changes in serum metabolic biomarkers, reducing harmful metabolites and increasing beneficial ones. The positive modulation of fecal SCFA concentrations, including acetate, butyrate, and propionate, played a pivotal role in gut health and overall well-being. The study also highlighted the potential impact of FBR on gene expressions related to GABA receptors in the brain, suggesting its therapeutic potential for disorders associated with brain relaxation. Additionally, our network pharmacology analysis identified among the top ten FBR bioactive compounds quercetin, GABA, glutamic acid, phenylalanine, and ferulic acid exhibits significant therapeutic potential for neurodegenerative disorders due to their multifaceted interactions with key protein targets. In summary, FBR emerges as a promising psychobiotic with multifaceted benefits in ameliorating chronic stress, anxiety, depression, and cognitive impairment. These effects are intricately linked to the modulation of the gut microbiota and their metabolites, neurotransmitter balance, and metabolic markers. Further research is needed to elucidate the underlying mechanisms and optimize dosing strategies, but these findings pave the way for future therapeutic interventions promoting mental well-being.
Given the global prevalence of anxiety and depression, future research should focus on delineating the precise mechanisms by which psychobiotic-fermented grains exert their effects. Areas for further study include identifying specific bacterial strains and metabolites responsible for observed benefits, optimizing fermentation conditions to maximize therapeutic efficacy, and conducting large-scale human clinical trials to establish dosage guidelines and long-term safety. Investigating the role of dietary fiber in synergistically enhancing psychobiotic effects and exploring personalized nutrition strategies based on individual gut microbiota profiles could further advance this field. These directions have the potential to transform psychobiotic-fermented grains into accessible, functional foods tailored to improve mental-health outcomes globally.
Materials and methods
Probiotic strain used in the study
The LAB Limosilactobacillus reuteri (L. reuteri) used in this study was obtained from the Department of Food Science and Biotechnology at Kangwon National University in South Korea. The bacterial strain was chosen because it has demonstrated great fermentation efficiency in our previous studies30,33. The bacteria stock culture was maintained at −80 °C in MRS broth (Difco) containing 20% glycerol (v/v) for further analysis.
Brown rice sample
Brown rice (BR) sample was purchased from a nearby grain market in Chuncheon, South Korea. Later BR sample is grounded into powder using an electric mill (Hanil electric co., Ltd., South Korea) and filtered through mesh size 40. The samples were kept at −20 °C for further research analysis.
FBR preparation
Sterilized brown rice powder was dissolved in distilled water to prepare the growth medium. The medium was autoclaved at 121 °C for 15 min before inoculation with LAB. A fermentation related bacterial strain, Limosilactobacillus reuteri, was then transferred from a 12-hour (overnight) culture into 100 mL of the autoclaved growth medium. The mixture was incubated at 37 °C with 150 rpm agitation for 48 h. After 48 h of fermentation, the resulting FBR or synbiotic sample was freeze-dried and stored at −20 °C for future research.
Experimental animals
This study followed the guidelines established by the UK, EU, and US Animal Research Reporting In Vivo Experiment. It was approved by the Institutional Animal Care and Use Committee (IACUC) of Kangwon National University, South Korea (Approval no. KW-210906-1). A total of 42, -week-old male ICR mice (30–35 g) were procured from Orient Bio (Gyeonggi-do, Korea). The mice were housed in a controlled environment at the Kangwon National University Laboratory Animal Center under a 12-hour light/dark cycle, a temperature of 20 ± 2 °C, and a relative humidity of 55 ± 5%. They were kept in ventilated cages with continuous access to a standard chow diet and water ad libitum. Following a one-week acclimatization period, the mice were randomly assigned into six groups, with seven mice per group (n = 42) for the duration of the experiment.
Experimental workflow
Figure 11 depicts the scheduling of experimental procedures. Normal group (Normal) contains non-stressed mice with balanced food and water ad libitum. This group of mice were kept in their living cages without being disturbed. The chronic stress procedure was carried out daily for 14 days to induce stress. After confirmation of anxiety, animals were divided into five groups based on the supplementary diet received during the 21 days. Five experimental groups other than normal/control were assigned: Chronically stressed (stress/vehicle), three stressed groups with candidate FBR (low-100 mg/kg BW, medium-500 mg/kg BW and high dose-1000 mg/kg BW) supplementation, FBR doses were selected based on literature review, toxicity, therapeutic effects, and prior experimental data. The high dose corresponds to the maximum concentration we have tested (1000 mg/mL) in vitro, remaining non-lethal (data not shown here). The medium dose is expected to be effective in vivo based on in vitro cytotoxicity and biological activity, while the low dose serves as a baseline and allows comparison with the drug Fluoxetine. These doses align with preclinical protocols for assessing dose-dependent responses, behavioral changes, and stress markers, providing a comprehensive evaluation of psychobiotics FBR for stress and anxiety.The fifth group in this study is stressed group with drug fluoxetine supplementation (100 mg/kg, BW). Mice were randomly assigned to groups (n = 7) and perorally gavaged with candidate FBR and drug. The mice were administered the candidate FBR and fluoxetine (drug) via oral gavage once daily for three weeks. Every day, freeze-dried FBR samples and fluoxetine were freshly diluted in 300 µl of saline as per the concentrations. Vehicle mice were gavaged with only 300 µl of saline solution per day. A disposable 1 ml syringe (Orient Bio, Gyeonggi-do, Korea) with a stainless-steel cannula (Orient Bio, Gyeonggi-do, Korea) was used for the peroral gavage. The mouse was gently restrained by holding the neck and back. The cannula was carefully inserted into the side of the mouth, positioned alongside the tongue, and guided downward to bypass the tongue. The contents were then slowly and directly injected into the stomach. Behavioral assessments were carried out on the second and fifth weeks to confirm stress induction and treatment using the Elevated plus maze test (EPMT), Open field test (OFT), Forced swim test (FST), and NOR (novel object recognition). Mice Feces samples were collected on the first day, the 14th day following stress induction, and the 35th day following treatment. The feces were stored at −80 °C until analysis. On the 36th day, the mice were anesthetized with ether and euthanized by cervical dislocation, and blood was collected. Plasma was isolated and stored at −80 °C after being pretreated with ethylenediaminetetraacetic acid (EDTA) during blood collection for corticosterone, serotonin, GABA, IL-6 and TNL-α detection.
Fig. 11
Depicts the schedule of experimental procedures.
CMS induction procedure
Two methods were used for stress induction: Immobilization for 2 h/day with subsequent exposure to electric foot shocks52. Seven mice at a time were tested for restrained stress in a stainless cage; the mice were fixed and unable to move (Supplementary Fig. 1a). The mice were subjected to 2 min of electric foot shock stress at 0.5 mA, 1 s with 10 s intervals (Supplementary Fig. 1b). Stressed mice were chronically exposed to identical stressors once a day for two weeks, while the normal control group was left undisturbed.
Body weight and food intake analysis
The mice’s food intake and body weight were recorded manually over 30 days at three days intervals. Before and after a feeding period, the amount of food consumed was weighed and calculated53.
Behavioral analysisElevated plus-maze test
The standard method for assessing the anxiolytic-like effects was EPMT. The EPMT apparatus had two open arms and two closed arms, each measuring 60 cm in length, 12 cm in width, and 40 cm in height. The apparatus was placed 100 cm above the ground. The 12-by-12-centimeter central platform served as the link between the arms. Mice were placed in the center of the maze, facing one of the closed arms, and given five minutes to explore. An arm was considered entered when all four paws crossed the dividing line. Using the video tracking program Viewer 3.0, the percentage of time spent in each arm was examined (Biobserve, Bonn, Germany). To eliminate olfactory cues, the maze was cleaned with ethanol following each test54.
Novel object recognition test
The NOR test was conducted to assess the cognitive abilities of the mice using a rectangular, black container measuring 40 cm in height, width, and length. During the habituation period, mice were allowed two days and a total of ten minutes to explore the box. On the third day, the mice were placed in the center of the box with two identical objects positioned 5 cm from the walls, and were given 10 min to investigate and demonstrate their object preference. After 24 h, the mice were returned to the center of the box for five minutes, with one of the original objects replaced by a novel object. In order to calculate the preference ratio for each object and the discrimination index, the ratio of exploration time and the time spent engaging in exploratory behaviors, such as contact, sniffing, and licking, to each object (novel object, Tnovel; familiar object, Tfamiliar), was recorded. Calculations were made to determine the discrimination index and the preference ratio for each item using formula = (Tnovel–Tfamiliar)/(Tnovel + Tfamiliar) × 10055.
Forced swim test
In the FST, individual mice were gently inserted into a Plexiglas cylinder (h × w 30 × 18 cm) that was filled with 30 cm of water at 25 ± 1 °C of temperature. The investigators, unaware of the group assignments, measured and recorded the mice’s immobility and struggling behavior throughout the 6-minute swim session. Immobility was defined as when a mouse floated without struggling, making only the minimal movements necessary to keep its head above the water. Whereas, struggling was defined as making vigorous movements with the forepaws to break the water56.
Open field test
OFT was used to assess the anxiety and spontaneous locomotion of mice. For 30 min, the mice were left to explore the center of a rectangular black box (l × w × h) 40 × 40 × 40 cm. The total ambulatory distance was calculated using the video tracking software Viewer 3.0 (Biobserve, Bonn, Germany). In order to score the entire area, the time traveled through a virtual central zone that was set at 50% of the distance from the edges. Following each test, the test box was cleaned with ethanol57.
Biochemical measurements
Corticosterone (the stress hormone), IL-6, TNF-α, and neurotransmitters like GABA and serotonin were measured in the plasma samples of different mice groups. Samples (blood/plasma) were examined using the Competitive EIA ELISA Kits for Mouse GABA (E4456-100, Biovision, Korea) and Serotonin (E4294-100, Biovision, Korea), Corticosterone (KGE009, R&D Systems, Korea), TNF-α (88-7346-22 ELISA Kit, Invitrogen, Korea, and IL-6 ELISA kit (K4144-100, Biovision, Korea) in accordance with the Kit’s instructions.
Metagenomics analysis using 16S rRNA sequencing
Fecal samples were collected on the first day, the 14th day following stress induction, and at the end of the treatment period. Macrogen, Inc. (Seoul, South Korea) performed the 16S rRNA metagenomic sequencing (V3-V4 region) according to the manufacturer’s guidelines (Illumina), using the Herculase II Fusion DNA Polymerase Nextera XT Index Kit V258. In summary, fecal genomic DNA was extracted, quality controlled, randomly fragmented, and then ligated with 5’ and 3’ adapters for sequence library construction. The prepared library was sequenced on the Illumina MiSeq platform, and the raw data were converted to FASTQ format. To summarize the taxonomic distribution of OTUs, these libraries were analyzed, and the results were used to estimate the relative abundances of microbiota at various levels.
MicFunPred was used to predict the metagenomic KEGG (Kyoto Encyclopedia of Genes and Genomes) functional profiles (http://micfunpred.microdm.net.in/).
Short-chain fatty-acid analysis
In all groups, we measured the three major SCFAs in feces: acetic acid, propionic acid, and butyric acid, using the protocol previously described by Pan and colleagues with some modifications59. Approximately 0.2 g of feces was placed in a 15-mL centrifuge tube, and 10 mL of water was added to dissolve the sample. The mixture was oscillated for 2 min, then centrifuged at 10,000 rpm and filtered through a 0.45 µm filter into a clean 15-mL centrifuge tube. About 2.0 mL of the filtered sample was mixed with 0.2 mL of a 50% sulfuric acid solution and 2.0 mL of ether, then oscillated 30 times, centrifuged for 5 min at 10,000 rpm, and refrigerated for 30 min at 4 °C. The upper ether layer was then subjected to GC/MS (Agilent, USA) analysis on a 30 m × 0.25 mm × 0.25 µm TG WAX column. Helium was used as the carrier gas at a constant flow rate of 0.8 mL/min in the GC-MS program. The injection port temperature was set to 200 °C, and the initial column temperature was 120 °C. The temperature was then increased to 150 °C at a rate of 5 °C/min, followed by an increase to 200 °C at a rate of 10 °C/min, and held at 200 °C for 2 min.
UHPLC-Q-TOF-MS/MS untargeted metabolomics for metabolites detection in plasma and fecal samples
Blood was collected from behaviorally validated adult mice via cardiac puncture in Microvette® tubes (Molecular devices, Busan, South Korea). The tubes were centrifuged at 10,000 g for 5 min at room temperature to extract the serum. Serum samples (200 µl) were vortexed for 2 h at room temperature with 70% methanol (200 µl). After centrifuging the mixture at 10,000 rpm for 10 min, 4 °C, the supernatant was filtered through a 0.45 µm membrane filter for metabolomics analysis using UHPLC-Q-TOF-MS/MS (AB SCIEX X500R Q-TOF).
At weeks 0, 2, and 6, mice feces were collected and stored at −80 °C for further analysis. A 100 mg sample was spiked with 50 µL of 5 gmL−1 chlorpropamide and extracted into 950 µL of methanol by thorough mixing on a vortex mixer, followed by 10 min of sonication. After centrifuging the mixture at 12,000 g for 10 min, the supernatant was filtered through a 0.45 µm membrane filter for UHPLC-Q-TOF-MS/MS analysis. Analysis was performed using our previous protocol60. Metabolites were identified by comparing retention time (RT) and UHPLC-Q-TOF-MS/MS data with spectral literature evidence and crosschecked with spectral libraries, i.e., XCMS Online (Metlin) (https://metlin.scripps.edu) and Metabolomics Workbench (https//www.metabolomicsworkbench.org)61.
Network pharmacology analysis
To gather screening information on target genes related to stress-related disorders and memory impairment, we consulted two databases DisGeNET and GeneCards. DisGeNET is a platform that integrates human diseases, genes, and experimental research62, while GeneCards is a comprehensive database that incorporates genomics, proteomics, genetics, clinical data, and transcriptomics63. We then imported the relevant bioactive metabolites from L.reuteri FBR and their interacting target genes into StringApp in Cytoscape version 3.8.0 to explore their pharmacological mechanism and construct a final PPI network based on draft network data64. We set the species to “Homo sapiens” and used a medium confidence score of 0.700 to ensure the reliability of our analysis. The Network Analyzer module in Cytoscape was used to validate the network65. To verify the identified genes associated with the target diseases, we cross-referenced them with the STITCH v5.0 server66.
The study utilized components derived from FBR to target genes associated with stress-related disorders, focusing on their functions and signaling pathways. The Database for Annotation, Visualization, and Integrated Discovery (DAVID) system database was used to analyze the functional annotation and KEGG pathway enrichment of proteins. The target proteins were analyzed in terms of their involvement in biological processes, cellular components (CC), molecular function (MF), and KEGG pathways. Using Cytoscape version 3.8.0 software, a network was constructed to show the interaction between the ingredients, targets, pathways, diseases, and components involved. The nodes in the network represent the components, diseases, targets, pathways, while the edges illustrate the interactions between these nodes67.
To investigate further, the tertiary structures of the hub proteins and chemical compounds were retrieved from the Protein Data Bank https://www.rcsb.org/ and DrugBank https://go.drugbank.com/, respectively. Molecular docking studies were carried out using AutoDock Vina 4.2.668 to evaluate the binding interactions between the hub proteins and ligands. The AMBER force field was employed as the scoring function to determine the free energy of interaction between the receptor and ligand molecules69. The Discovery Studio Visualizer 2017 was utilized for the visualization of the docked complex. The most potent inhibitor was identified based on the binding score, as well as hydrogen bond and hydrophobic interactions, for the treatment of stress-related disorders.
Expression analysis of GABA receptors in the prefrontal cortex
In the validation experiment, we assessed the expression levels of GABAAα2 and GABAB1β receptors in the prefrontal cortex of mice. Tissue homogenization was performed using high-speed shaking with a 1 mm stainless-steel bead in 1 ml of QIAzol lysis reagent. Following chloroform addition, RNA was isolated from the aqueous phase via centrifugation and purified using the miRNeasy Mini Kit. Residual DNA was removed with Turbo DNase (Invitrogen), and RNA was reverse-transcribed to cDNA using ReadyScript cDNA Synthesis Mix (Sigma-Aldrich). Quantitative PCR (qPCR) was conducted in triplicate with SYBR Green, using β-actin (ACTB) as the housekeeping gene. Receptor Primer sequences used in our study were: GABAAα2: Forward, GGAAGCTACGCTTACACAACC; Reverse, CATCGGGAGCAACCTGAA. GABAB1β: Forward, CGCACCCCTCCTCAGAAC; Reverse, GTCCTCCAGCGCCATCTC. ACTB: Forward, ATGCTCCCCGGGCTGTAT; Reverse, CATAGGAGTCCTTCTGACCCATTC. This precise methodology ensured reliable quantification of receptor gene expressions70.
Statistical analysis
OriginPro 2022 was used to analyze the data (OriginLab, Northampton, MA, USA). The results were presented as the mean, standard deviation of at least triplicate analyses determined by one-way ANOVA followed by Tukey’s test at the figures by *p < 0.05,**p < 0.01, ***p < 0.001 significance level. The FDR at p < 0.05 was considered statistically significant for volcano plots. The Clustvis online platform was used to create heat maps (http://biit.cs.ut.ee/clustvis/). The GABA receptor gene expression data was initially subjected to the ΔΔ CT and Fold values algorithm, which measured relative differential expression. Subsequently, a non-parametric approach was employed to analyze the data, utilizing the Kruskal-Wallis test for overall comparison and the Nemenyi post hoc test for further pairwise comparisons. Data analysis was also performed using GraphPad Prism software version 10, developed by GraphPad Software Inc., located in La Jolla, CA, USA.
Data availability
The authors declare that all data supporting this study’s findings are included in the article and in supplementary information. Raw data can be made available upon request.
References
|
|