숙주, 응애, 바이러스 상호간 복잡한 전염 및 경로 (논문)

[꿀벌나라]

바이러스 감염 경로에 대한 처음 자료로 (2005년 자료) 다 알지만, 그냥 읽어 봅니다. 

Intricate transmission routes and interactions between picorna-like viruses (Kashmir

bee virus and sacbrood virus) with the honeybee host and the parasitic varroa mite

꿀벌 숙주와 기생충 바로아 응애에 대한 피코르나 유사 바이러스(캐시미르 벌 바이러스 및 낭충병 바이러스)

사이의 복잡한 전염 경로 및 상호 작용

Miaoqing Shen, Liwang Cui, Nancy Ostiguy and Diana Cox-Foster Correspondence Diana Cox-Foster dxc12@psu.edu

Department of Entomology, The Pennsylvania State University, 501 ASI Building, University Park, PA 16802, USA

미아오칭 셴, 리왕 쿠이, 낸시 오스티유, 다이애나 콕스 포스터

펜실베니아 주립대, 곤충학부 501 ASI Building, University Park, PA 16802, USA 

Received 31 January 2005 Accepted 11 March 2005

ABSTRACT

요약

Viral diseases of honeybees are a major problem in apiculture, causing serious economic losses worldwide, especially in

combination with varroa mites. To increase understanding of the relationship among viruses, mites and colony decline,

the tripartite relationships among bees, viruses [Kashmir bee virus (KBV) and sacbrood virus (SBV)] and varroa mites

have been investigated systematically.

꿀벌의 바이러스성 질병은 양봉의 주요한 문제이며, 특히 바로아 응애와 결합하여 전 세계적으로 심각한

경제적 손실을 초래한다.  바이러스, 응애 및 봉군 감소에 대한 관계의 이해를 높이기 위해, 벌, 바이러스

[캐시미르 벌 바이러스 (KBV) 및 낭충병 바이러스 (SBV)] 및 바로아 응애 간의 삼자 관계가 체계적으로

조사되었다

To develop an antibody-based test for KBV, two structural recombinant proteins were purified for polyclonal-antibody

production. By using ELISA and RT-PCR, the presence of KBV and SBV was studied comparatively in different

developmental stages and castes of bees. The results demonstrated that KBV may persist as a viral genome with

extremely low levels of viral-capsid proteins and that KBV and SBV can co-infect honeybees.

KBV에 대한 항체 기반 테스트를 개발하기 위해, 폴리코날 항체 생산을 위해 두 개의 구조적 재조합 단백질

을 정제했다.  ELISA 및 RT-PCR을 사용하여 캐시미르 벌 바이러스 및 낭충병 바이러스의 존재를 꿀벌의 다른

진화 단계와 계급에서 비교하여 연구했다.  결과는 KBV는 극도로 낮은 수준의 바이러스 캡시드 단백질을

가진 바이러스 게놈으로 지속될 수 있으며 KBV와 SBV가 꿀벌을 공동 감염시킬 수 있음을 보여 주었다.

주) 포리코날 항체 : 체내의 다른 B 세포 계통에 의해 분비되는 항체.

This study indicated the presence of KBV and SBV RNAs in both queens and eggs by RT-PCR, suggesting a route of

transovarial transmission. Horizontal transmission is also very likely among adult bees and from adult workers to larvae

through contaminated food resources, because both viruses have been detected in all developmental stages and food

sources (brood food, honey, pollen and royal jelly)

이 연구는 RT-PCR에 의해 여왕벌과 알 모두에서 KBV 및 SBV RNA의 존재를 나타내어, 경란전염의 경로를

암시한다.  수평 전염은 오염된 식량 자원을 통해 성봉과 성봉 일벌에서 유충까지 가능성이 매우 높다, 모든

발달 단계와 식량 재료 (유충 식량, 꿀, 화분 및 로열 젤리)에서 두 바이러스가 모두 검출 되었기 때문이다.

Furthermore, it was demonstrated that mites were another possible route of horizontal transmission, as both viruses were

detected in mites and their saliva. This study, for the first time, detected co-occurrence of viruses in varroa, further

underlining the importance of the mites in vectoring different bee viruses. Therefore, these results indicated that multiple

infection routes exist for honeybee viral diseases.

또한, 응애와 침에서 두 바이러스가 모두 검출 되었기 때문에, 응애가 수평 전파의 또 다른 가능한 경로임을

입증했다.  이 연구는, 처음으로 바로아에서 바이러스의 동시 발생을 감지하여, 다른 벌 바이러스를 매개하는데

있어 진드기의 중대성을 더욱 강조한다.  따라서 이러한 결과는 꿀벌 바이러스 질병에 대해 여러 감염 경로가

존재함을 나타내었다.

INTRODUCTION

서론

The honeybee is a eusocial insect; the bee colony is headed by a single queen and is composed of approximately

50 000 individuals (Morse & Hooper, 1985). Many diseases can impact negatively on both feral and domesticated

honeybee populations, causing serious economic losses. So far, 18 viruses have been identified from honeybees

(Allen & Ball, 1996).

꿀벌은 진사회적 곤충이다 ; 꿀벌 봉군은 한 마리의 여왕벌이 이끄는 약 5만 마리의 개체로 구성된다.

많은 질병들은 야생 과 양봉 꿀벌 개체수 모두에 부정적인 영향을 미치고 심각한 경제적 손실을 초래할

수 있다. 지금까지 꿀벌에서 18개의 바이러스가 확인되었다.

Although much research has been done on the characterization of bee viruses, little is known about the transmission routes

of bee viruses and the relationship with varroa mites. Disease transmission in the honeybee society may serve as a model

system for disease transmission in the human society.

꿀벌 바이러스의 특성화에 대한 많은 연구가 수행되었지만, 꿀벌 바이러스의 전파 경로와 바로아 응애와의

관계에 대해서는 알려진 바가 거의 없다.  꿀벌 사회의 질병 전염은 인간 사회의 질병 전염 모델 시스템의

역할을 할 수 있다.

Some bee viruses belong to the family Dicistroviridae, which includes Cricket paralysis virus (CrPV). Members of the family

Dicistroviridae have some similarities to the picornaviruses. The CrPV proteins are translated from the RNA genome as two

separate polyproteins; the translational regulation of the second polyprotein is unique and depends upon an internal

ribosome entry site (IRES) at an internal position in the RNA (Jan et al., 2003; Nakashima et al., 1999;

Sasaki & Nakashima, 1999, 2000).

일부 꿀벌 바이러스는 크리켓 마비 바이러스 (CrPV)를 포함하는 Dicistroviridae과에 속합니다. Dicistroviridae

과의 구성원은 피코나 바이러스와 몇 가지 유사점을 가지고 있다. CrPV 단백질은 리보핵산 게놈에서 두 개의

분리된 다단백질로 번역됩니다. 두 번째 다단백질(多蛋白質)의 번역 조절은 독특하며 RNA의 내부 위치에 있는 

내부 리보솜 유입점(內部~流入點) (IRES)에 따라 다르다

[유전학] 번역: RNA 정보에 입각한 아미노산 합성.

The CrPV intergenic-region IRES initiates translation by recruiting 80S ribosomes in the absence of initiator Met-tRNA

(Jan et al., 2003). We have focused upon two viruses, Kashmir bee virus (KBV) and sacbrood virus (SBV). The complete

nucleotide sequences of KBV and SBV are available (de Miranda et al., 2004; Ghosh et al., 1999).

CrPV 유전자간 영역 IRES는 개시제 Met-tRNA가 없는 경우에 80S 리보솜을 동원함으로써 번역을 시작한다

(Jan et al., 2003). 우리는 캐시미어 벌 바이러스 (KBV)와 낭충병 바이러스 (SBV)의 두 가지 바이러스에 중점을

두었다. KBV 및 SBV의 완전한 뉴클리오타이드 서열을 사용할 수 있습니다 (de Miranda et al., 2004;

Ghosh et al., 1999).

주) nucleotide : 핵산의 구성 성분

KBV was first identified in adults of the eastern hive bee (Apis cerana) in the northern and western regions of India

(Bailey & Woods, 1977). Bees infected with KBV have no described symptoms, even though Bailey & Ball (1991) and

Allen & Ball (1995) suggested that KBV is the most virulent of all known honeybee viruses.

KBV는 인도 북부 및 서부 지역의 동양종벌 (Apis cerana)의 성충에서 처음 확인되었다 (Bailey & Woods, 1977). 

베일리 & 볼 (1991)과 알렌 & 볼 (1995)은 KBV가 알려진 모든 꿀벌 바이러스 중에서 가장 발병력 있다고 제안

했지만, KBV에 감염된 꿀벌은 기술된 증상이 없다.

SBV was first described in 1913, but was not characterized until 1964 (Bailey et al., 1964). SBV is possibly the most common

viral disease of bees, being known on every continent (Dall, 1985; Nixon, 1982). SBV infects the brood of the honeybee,

resulting in larval death. Larvae with sacbrood fail to pupate and ecdysial fluid, rich in SBV, accumulates beneath their unshed

cuticle, forming the sac.

SBV는 1913 년에 처음 기술되었지만, 1964년까지 특징을 나타내지 않았다. SBV는 모든 대륙에서 알려진 아마

꿀벌의 가장 흔한 바이러스성 질병이다. SBV는 꿀벌의 유충 감염시켜 유충울  죽게 한다. 낭충병을 가진 유충은

번데기화에 실패하고, SBV가 풍부한 탈피 관련 액체가 흘리지 않는 표피 아래에 축적되어 낭을 형성한다.

ecdysial : 형용사 Relating to ecdysis (탈피와 관련이 있는)

SBV may also infect adult bees without any obvious signs of disease. Compared with KBV, SBV causes symptoms that can

confidently be attributed to viral infection (Allen & Ball, 1996). Varroa was first described as a natural ectoparasitic mite of

the eastern honeybee (A. cerana) and then switched host to the western honeybee (Apis mellifera) (Morse & Flottum, 1997).

SBV는 또한 어떤 명백한 질병의 징후 없이 성봉을 감염시킬 수 있다. KBV와 비교하여, SBV는 자신있게 바이러스

감염의 원인일 수 있다는 증상을 유발한다 (Allen & Ball, 1996). 바로아는 처음에 동양종 꿀벌 (A. cerana)의

자연적인 외부 기생충 응애로 묘사된 후, 서양종 꿀벌 (Apis mellifera)의 숙주로 전환되었다

(Morse & Flottum, 1997).

Varroa has now become a serious pest of western honeybees worldwide and is associated with the collapse or death of

honeybee colonies. Varroa females initiate reproduction by entering the brood cells of last-stage worker or drone larvae

before the cell is sealed.

바로아는 이제 전세계적으로 서양종 꿀벌의 심각한 해충이 되었고 꿀벌 봉군의 붕괴 또는 죽음과 관련이 있다. 

바로아 암컷은 벌방이 봉개하기 전에 마지막 단계 일벌 또는 수벌 유충방에 들어가서 번식을 시작한다.

The adult female mite and progeny feed on the haemolymph of pupae and emerge from the cell with the young bee.

Varroa mites are also often found on the thorax and abdomen of adult bees and may hitch a ride on bees from a

colony to infect other colonies. It is not clear how mites kill bee colonies, but the general assumption is that

varroa mites may be vectors or ctivators of several bee viruses.

성체 암컷 응애와 새끼는 번데기의 혈림프를 빨아 먹고 유봉과 함께 벌방에서 나온다. 바로아 응애는 성봉의

흉부와 복부에서도 종종 발견되며 다른 봉군을 감염시키기 위해 봉군에서 벌 위에 올라탄다. 응애가 꿀벌

봉군을 죽이는 방법은 명확하지 않지만, 일반적인 가정은 바로아 응애가 여러 꿀벌 바이러스의 매개충 또는

촉매가 될 수 있다는 것이다.

Some researchers suggest that varroa-mite infestation may be correlated with viral infections (Ball & Allen, 1988;

Hung & Shimanuki, 1999; Hung et al., 2000). However, there is little direct evidence to link varroa mites with the occurrence

of SBV in adult bees (Ball & Allen, 1988). Multiple opportunities exist for transmission by mites, given the association of the

mites with honeybees.

일부 연구자들은 바로아 응애 만염이 바이러스 감염과 관련이 있을 수 있다고 암시를 한다. 그러나 바로아

응애와 성봉의 SBV 발생을 연결하는 직접적인 증거는 거의 없다. 응애와 꿀벌의 연관성을 고려할 때, 응애에

의한 전염에는 다양한 기회가 존재한다.

Several methods have been used to detect bee viruses, including immunodiffusion, ELISA, Western blot and RT-PCR

(Anderson & Gibbs, 1988; Grabensteiner et al., 2001; Hung & Shimanuki, 1999; Stoltz et al., 1995; Turcu et al., 1994).

Diagnosis of bee viruses based on observed symptoms is not always dependable, as bees infected with many viruses

may have no symptoms and the viruses are capable of remaining dormant for extended periods of time without any

apparent harm to the host.

면역확산법(免疫擴散法), 효소면역측정법(~酵素免疫測定法), 특수 단백질 검출 검사 및 RT-PCR을 포함한

여러 방법이 꿀벌 바이러스를 검출하는데 사용되었다. 관찰된 증상에 근거한 꿀벌 바이러스의 진단은 항상

신뢰할 수 있는 것은 아니다. 많은 바이러스에 감염된 꿀벌은 증상이 없을 수 있고 바이러스는 숙주에 

명백한 피해 없이 장기간 휴면 상태를 유지할 수 있기 때문입니다.

Dall (1985) reported that both KBV and SBV persisted as inapparent infections in seemingly healthy worker-bee pupae

and the viruses replicated to detectable concentrations when the pupae were injected with rabbit sera or insect Ringer's

solution. The persistence of inapparent viral infections in honeybees has some similarities to infections by picornaviruses

and other viruses within the picornavirus ‘superfamily’.

Dall (1985)은 KBV와 SBV가 모두 건강한 일벌 번데기에서 불명확한 감염으로 지속되었고, 번데기에 토끼

혈청이나 곤충 링거 용액을 주입했을 때 바이러스는 검출 가능한 농도로 복제 되었다고 보고했다. 꿀벌의

불명확한 바이러스 감염의 지속성은 피코르나 바이러스 '상과(上科), 내의 피코르나 바이러스 및 다른

바이러스에 의한 감염과 약간 유사성을 띤다.

For example, Foot-and-mouth disease virus is a member of the family Picornaviridae and may cause a prolonged,

asymptomatic and persistent infection in ruminants (Alexandersen et al., 2002). Girard et al. (2002) reported that

Poliovirus persisted in the central nervous system of infected paralysed mice for over a year after the acute phase of

paralytic poliomyelitis.

예를 들어, 구제역 바이러스는 Picornaviridae과의 일원이며 반추 동물에서 장기간 무증상 및 지속적인

감염을 일으킬 수 있다 . Girard 외는. (2002)는 폴리오 바이러스가 마비성 소아마비의 급성기 이후 1년

이상 동안 감염된 마비된 쥐의 중추 신경계에서 지속되었다고 보고했다.

Viral transmission between bees is poorly understood. KBV is detected in the faeces of worker and queen honeybees

(A. mellifera) (Hung, 2000). The study by Hung (2000) indicated that the queen can be infected, but did not demonstrate

direct evidence for transmission via faeces. The queen, under normal conditions, is responsible for laying all of the eggs

in the colony (several hundred to thousands per day).

꿀벌 간의 바이러스 전염은 잘 알려져 있지 않다. KBV는 일벌과 여왕벌의 배설물에서 발견된다 (서양종 꿀벌).

Hung (2000)의 연구에 따르면 여왕벌은 감염 될 수 있지만, 배설물을 통한 전염에 대한 직접적인 증거는

입증되지 않았다. 여왕벌은 정상적인 조건에서 봉군에 모든 알을 낳는 책임이 있다 (하루에 수백에서 수천).

It is possible that the queen could transmit viruses to eggs by transovarial transmission. Previously, there have been no

reports of viruses in honeybee eggs. Another route of transmission may be through the food consumed by the larvae and

adult bees. The vast majority of individuals in a bee colony are worker bees, which are responsible for feeding the colony.

For the first 2 or 3 weeks of adult life, workers stay inside the hive and feed the brood and queen.

여왕벌이 경란 전염을 통해 바이러스를 알에 전염시킬 수 있다. 이전에는, 꿀벌 알에 바이러스에 대한보고가

없었다. 또 다른 전염 경로는 유충과 성봉이 섭취하는 음식을 통해서 일 수 있다. 꿀벌 봉군에 있는 대부분의

개체는 일벌이며, 봉군에 먹이를 주는 책임이 있다. 성봉 일생의 처음 2~3 주 동안, 일벌은 벌통에 머물며

유충과 여왕벌에게 먹이를 준다.

After this period, the workers forage and bring back nectar, pollen and water. All of these food products are stored and

used to feed the larvae, queen and other adults. All of the food, including honey, pollen and royal jelly, is in part

composed of secretions from the hypopharyngeal and mandibular glands of the young adult workers. The queen larvae

are always mass-fed a diet of royal jelly.

이 기간이 지나면, 일벌들은 꽃꿀, 화분 및 물을 찾아서 가져 온다. 이러한 모든 식품은 저장되어 유충, 여왕벌

및 다른 성봉에게 먹이를 주기 위해 사용된다. 꿀, 화분, 로열 젤리를 포함한 모든 음식은, 부분적으로 유봉

일벌의 하인두 및 하악선에서 나온 분비물로 부분적으로 구성된다. 여왕벌 유충은 항상 로열 젤리 식단을

대량으로 먹는다.

Worker larvae are also mass-fed royal jelly for the first 3 days. After the fourth day, the worker larvae are fed,

progressively or as needed, with a diet called worker jelly or brood food. This diet consists of royal jelly, honey

and probably some pollen. Bailey (1969) showed that more SBV accumulated in the heads and especially in the

hypopharyngeal glands of infected worker bees.

일벌 유충도 첫 3일 동안 로열 젤리를 대량으로 먹인다. 4일 후에, 일벌 유충에게 일벌 젤리 또는 유충 음식

이라고 하는 식단을 점진적으로 또는 필요에 따라, 먹인다. 이 식단은 로열 젤리, 꿀, 아마도 약간의 화분으로

구성된다. 베일리 (1969)는 더 많은 SBV가 머리, 특히 감염된 일벌의 하인두선에 축적되었음을 보여주었다.

Therefore, SBV may potentially be transmitted via glandular secretions of the worker bees in the form of food products,

but this has not been demonstrated previously. In this paper, we have developed specific and sensitive methods for

diagnosis of KBV infection and studied the presence of KBV in single bees comparatively by ELISA and RT-PCR.

따라서, SBV는 식품 형태로 일벌의 하악선선 분비물을 통해 잠재적으로 전염될 수 있지만, 이전에는 입증되지

않았다. 이 논문에서, 우리는 KBV 감염의 진단을 위한 구체적이고 민감한 방법을 개발하고  효소면역측정법

(~酵素免疫測定法)과 RT-PCR을 통해 단일 꿀벌에서 KBV의 존재를 비교 연구했다.

To better define the potential transmission routes for bee viruses, we have compared the presence of KBV and SBV in

different developmental stages and castes of bees. We have determined whether KBV and SBV could be transmitted from

queen bees to eggs via transovarial transmission by testing for viral RNA and capsid proteins in queen bees and viral RNA

in egg samples.

꿀벌 바이러스에 대한 잠재적인 전파 경로를 더 잘 정의하기 위해, 우리는 꿀벌의 다양한 발달 단계와 계급에서

KBV와 SBV의 존재를 비교했다. 우리는 여왕벌의 바이러스 RNA 및 캡시드 단백질과 알 샘플의 바이러스 RNA를

테스트하여 KBV 및 SBV가 경란 전염을 통해 여왕벌에서 난자로 전염될 수 있는지 여부를 결정했다.

We were also interested in determining whether food sources (brood food, honey, pollen and royal jelly) were contaminated

by these viruses and could be potential sources for horizontal transmission of viruses. In addition, this research provides

direct evidence for the potential role of varroa mites in vectoring bee viruses (KBV and SBV). Overall, this research increases

our understanding of the complex relationships among honey bees, varroa mites and viral infections.

우리는 또한 식품 공급원 (유충 음식, 꿀, 화분 및 로열 젤리)이 이러한 바이러스에 의해 오염되어 바이러스의

수평 전염의 근원이 될 수 있는지 밝혀내는데 관심이있었다. 또한, 이 연구는 꿀벌 바이러스 (KBV 및 SBV)를

벡터링하는 데있어 바로 아 진드기의 잠재적인 역할에 대한 직접적인 증거를 제공합니다. 전반적으로이 연구는

꿀벌, 바로아 응애 및 바이러스 감염 간의 복잡한 관계에 대한 우리의 이해를 증가시킨다.

METHODS

방법

Sample collections.

샘플 수집 

In total, 94 healthy-appearing bees of different developmental stages (larvae, pupae and adults) and castes (queen, worker

and drone bees) were collected from 20 colonies in four different apiaries (Penn State, Airport, Hilltop and Rockspring

apiaries). The Penn State, Hilltop and Airport apiaries are 4 miles (6·4 km) away from each other and about 30 miles (48 km)

away from the Rockspring apiary.

총, 94마리의 각기 다른 발달 단계(유충, 번데기, 성봉)와 카스트(여왕벌, 일벌, 수벌)의 건강해 보이는 벌이

4개의 서로 다른 양봉장에 있는 20개 봉군(펜실베니아 주, 에어포트, 힐탑, 록스프링 사파리아 양봉장) 에서

수집되었다. 펜실베니아 주, 힐탑 및 에어포트 양봉장은 서로 4 마일 (6 · 4km), 그리고 록스프링 양봉장에서는

약 30 마일 (48km) 떨어져 있다.

Among them, colonies 214 and 216 from the Airport apiary had experienced increased mite levels and decreased numbers

of bees, and eventually collapsed. Colony 14, a 2-year-old colony from the Penn State apiary, had been maintained for high

levels of varroa-mite infection and had known KBV and SBV infections, but exhibited little or no symptoms of viral infection.

Female adult varroa mites were also collected from colony 14.

그 중에서, 에어포트 양봉장의 봉군 214와 216은 응애 수준은 증가하고 벌 수가 감소하여 결국 붕괴되었다.

펜실베니아 주 양봉장의 2 년된 봉군인 봉군 14는 높은 수준의 바로아 응애 감염에 대해 유지되었으며 KBV 및

SBV 감염이 알려져 있었지만, 바이러스 감염의 증상이 거의 또는 전혀 나타나지 않았다. 암컷 성체 바로아 응애도

또한 봉군 14에서 수집되었다.

To develop and validate the methods for KBV detection, 16 5-day-old pupae collected from colony 15 in the Penn State

apiary were injected with 4 μl ELISA KBV-positive samples. Fifteen uninjected pupae from the same colony served as controls.

KBV 검출 방법을 개발하고 검증하기 위해 펜실베니아 주 양봉장 15번 봉군에서 채취한 5 일령 번데기 16 마리에

4 μl 효소면역측정법(~酵素免疫測定法) KBV 양성 샘플을 주입했다. 같은 봉군에서 나온 15 마리의 주사되지 않은

번데기는 대조군 역활을 했다.

Both the injected and uninjected pupae were incubated on dry filter paper in small Petri dishes placed in a larger Petri dish

lined with filter paper wetted with 12 % glycerol to humidify the air, and were kept in an incubator (35 °C, relative humidity

50 %) for 4 days.

주입된 번데기와 주입되지 않은 번데기 모두 공기를 가습하기 위해 12 % 글리세롤로 적신 여과지로 늘어선 더

큰 페트리 접시에 놓인 작은 페트리 접시에 있는 건조 여과지에서 배양하고, 인큐베이터 (35 ° C, 상대 습도

50 %)에  4 일 동안 보관했다. 

Egg samples were collected carefully from individual cells and washed well with distilled water. For each sample, 20 eggs

were pooled and tested. The larval, pupal and adult bees were frozen at −80 °C. To test the presence of viruses in food

resources, larval food and royal jelly were collected carefully from cells by removing the worker or queen larvae.

Pollen and honey were collected from comb cells.

알 샘플은 개별 벌방에서 조심스럽게 수집하고 증류수로 잘 세척했다. 각 샘플에 대해, 20개의 알을 모아서

테스트했다. 유충, 번데기 및 성봉은 -80 ° C에서 냉동되었다. 식량 자원에 바이러스의 존재 여부를 확인하기

위해, 일벌이나 여왕벌 유충을 제거하여 벌방에서 유충 먹이와 로열 젤리를  조심스럽게 수집했다. 화분과

꿀은 벌방에서 수집되었다.

Sample preparations.

샘플 준비

The larval, pupal and adult bees frozen at −80 °C were cut into half laterally, with one half used for ELISA and the other

half for RT-PCR. For ELISA, the half-single-bee samples were homogenized in 400 μl extraction buffer (PBS with 0·2 %

diethyldithiocarbamate) and clarified with chloroform. Mites, tested for ELISA, were divided randomly into nine groups

of 12 mites each.

-80 ° C에서 냉동된 유충, 번데기 및 성봉은 측면으로 절반으로 자르고, 절반은 효소면역측정법으로 사용하고

나머지 절반은 RT-PCR에 사용했다. 효소면역측정법의 경우, 반쪽 단일 꿀벌 샘플을 400μl 추출 완충액 (0 .2 %

디에틸디티오카르밤산염이 포함된 PBS)에서 균질화하고 클로로포름으로 정제했다. 효소면역측정법에 대해

테스트된 응애는 각각 12개의 응애로 9개 그룹으로 무작위로 나누었다.

Extracts from each group of mites in 60 μl extraction buffer were prepared in a similar manner as for the bee samples.

Supernatants of the sample extracts were kept on ice and used directly for ELISA or saved at −20 °C for future use.

To test whether mite saliva contains KBV, mites were allowed to feed on sterile tissue-culture medium through an

artificial membrane (20–25 mites per membrane).

60μl 추출 완충액에서 각 그룹의 응애 추출물은 꿀벌 샘플에 대해 유사한 방식으로 준비되었다. 샘플 추출물의

상층 액을 얼음에 보관하고  효소면역측정법으로 직접 사용하거나 향후 사용을 위해 -20 ° C에 보관했다. 응애

타액에 KBV가 포함되어 있는지 테스트하기 위해, 응애를 인공막 (막당 20 ~ 25 개의 진드기)을 통해 멸균 조직

배양 배지를 먹도록 하였다.

After 24 h, the culture medium was collected and assayed for KBV by ELISA.

For RT-PCR, total RNA from the bee samples (pooled eggs, larvae, pupae and adults), mites and food sources

(larval food, royal jelly, pollen and honey) was extracted by using TRIzol reagent (Invitrogen). RNA from the egg

and mite samples was resuspended in 10 μl DEPC-treated water.

24시간 후, 배양 배지를 수집하고  효소면역측정법으로 KBV에 대해 분석하였다. RT-PCR의 경우,

TRIzol 시약 (Invitrogen)을 사용하여 꿀벌 샘플 (모은 알, 유충, 번데기 및 성봉), 응애 및 먹이 공급원

(유충 먹이, 로열 젤리, 화분 및 꿀)에서 총 RNA를 추출했다. 난자와 응애 샘플의 RNA를 10μl DEPC

처리된 물에 재현탁했다.

Expression‎ of KBV proteins in bacteria, and polyclonal antibodies.

박테리아에서 KBV 단백질의 발현과 다클론 항체.

Two fragments of KBV, AD and Odt (Fig. 1aF1), were cloned directionally into pQE-30 (Qiagen). Expression‎ and purification

of the recombinant proteins were performed by using Ni-NTA columns under denaturing conditions according to the

manufacturer's instructions (Qiagen).

 KBV, AD 및 Odt의 두 조각 (그림 1aF1)은 pQE-30 (Qiagen)에 방향적으로 복제하였다. 재조합 단백질의

발현 및 정제는 제조업체의 지시서 (Qiagen)에 따라 변성 조건에서 Ni-NTA 컬럼을 사용하여 수행되었다.

The recombinant proteins were further purified by preparative SDS-PAGE (12 % gel) (Sambrook et al., 1989). The protein

bands of interest were excised and electro-eluted. The purified proteins were dialysed in PBS and used to raise polyclonal

antisera (Pocono Rabbit Farm and Laboratory Inc., Canadensis, PA, USA).

재조합 단백질은 예비 SDS-PAGE (12 % 겔)에 의해 추가로 정제되었다. 관심있는 단백질 밴드를 잘라내고

전기용출시켰다. 정제된 단백질을 PBS에서 투석하고 다클론성 항혈청 (Pocono Rabbit Farm and Laboratory

Inc., Canadensis, PA, USA)을 발생시키는 데 사용했다.

The antiserum against another structural protein, VP4, was produced against KBV VP4 (Stoltz et al., 1995) and received

as a gift from Dr Don Stoltz, Dalhousie University, Canada.

다른 구조 단백질인, VP4에 대한 항혈청은 KBV VP4 (Stoltz et al., 1995)에 대해 생산되었으며 캐나다

달호우지 대학의 돈 스톨츠 박사로부터 선물로 받았다.

ELISA and Western blot.

효소면역측정법 및 특수 단백질 검출 검사.

Ninety-six-well microplates were coated with 50 μl extraction from bees or varroa mites in 150 μl sodium carbonate buffer

(coating buffer, pH 9·8) at 4 °C overnight. After rinsing each well three times in PBS-T (PBS with 0·05 % Tween 20), diluted

antibodies (1 : 2000) in PBS-T containing 2 % polyvinylpropylene and 0·2 % BSA were added and the wells were incubated

at 37 °C for 3 h.

96 웰 마이크로 플레이트를 150μl 탄산나트륨 완충액 (코팅 완충액, pH 9 · 8)에서 꿀벌 또는 바로아 응애로

부터 추출물로 50μl로 4 ° C에서 밤새 코팅했다. PBS-T (0 · 05 % Tween 20이 포함된 PBS)에서 각 웰을 3회

씻어 낸 후, 2% 폴리비닐프로필렌과 0 · 2 % BSA를 포함하는 PBS-T에 희석된 항체 (1 : 2000)를 첨가하고

웰을 3h 동안 37 °C에서 배양하였다.

After rinsing each well three times with PBS-T, the wells were incubated with horseradish peroxidase-conjugated protein

A (Sigma) (final concentration, 0·08 μg ml−1) at 37 °C for 2 h. Immobilized enzyme was detected colorimetrically by

adding the peroxidase substrate 3, 3′, 5, 5′-tetramethylbenzidine (0·1 mg ml−1). The end-point A 450 was measured by

using a Spectra Max 250 microplate spectrophotometer (Molecular Devices).

PBS-T로 각 웰을 3회 씻어 낸 후, 웰을 겨자 과산화 효소 결합 단백질 A (Sigma) (최종 농도, 0 · 08 μg ml-1)

와 함께 37 °C에서 2시간 동안 배양했다. 과산화 효소 기질 3, 3 ', 5, 5'-tetramethylbenzidine (0 .1 mg ml-1)

을 첨가하여 고정화된 효소를 비색계(比色計)로 검출하였다. Spectra Max 250 마이크로 플레이트 분광 광도계

(분자 장치)를 사용하여 종점 A 450을 측정했다.

Healthy bees negative by RT-PCR for KBV and SBV infections were used as ELISA negative controls. Twice the mean level

of reaction of each antibody with healthy bees was subtracted from the absorbance of each sample to correct for the

background level of reaction and to set the baseline for a positive reaction.

KBV 및 SBV 감염에 대한 RT-PCR 음성으로 건강한 꿀벌이  효소면역측정법 음성 대조군으로 사용되었다.

건강한 꿀벌과 각 항체의 평균 반응 수준의 두 배를 각 샘플의 흡광도에서 빼서 반응의 배경 수준을 수정하고

양성 반응에 대한 기준선을 설정했다.

Approximately equal amounts of bee extracts were separated by SDS-PAGE (12 % gel) and transferred to nitrocellulose

membranes for Western blot analyses (Harlow & Lane, 1999; Sambrook et al., 1989). RT-PCR.The genomic sequences

of SBV (GenBank accession no. AF092924) and KBV (GenBank accession no. AY275710) were aligned by using the

Genetics Computer Group (GCG) program, version 10.1.

대략 동일한 양의 꿀벌 추출물을 SDS-PAGE (12 % 겔)로 분리하고  특수 단백질 검출 검사 분석을 위해

니트로셀룰로오스 막으로 옮겼다 . RT-PCR. SBV (GenBank 수탁 번호 AF092924) 및 KBV (GenBank

수탁 번호 AY275710)의 게놈 서열은 Genetics Computer Group (GCG) 프로그램 버전 10.1을 사용하여

정렬되었다.

Primers were designed for their specificity to KBV (KBV-F, ATGACGATGATGAGTTCAAG; KBV-R, AATTGCAAGACCTGCATC)

or SBV (SBV-F, CACTCAACTTACACAAAAAC; SBV-R, CATTAACTACTCTCACTTTC). Primers (actin-F, ATGAAGATCCTTACAGAAAG;

actin-R, TCTTGTTTAGAGATCCACAT) were used to amplify 514 bp of the honeybee actin gene (GenBank accession no.

BI504901) as an internal control. 

기본 지침서는 KBV (KBV-F, ATGACGATGATGAGTTCAAG; KBV-R, AATTGCAAGACCTGCATC) 또는 SBV

(SBV-F, CACTCAACTTACACAAAAAC; SBV-R, CATTAACTACTCTCACTTTC)에 대한 특이성을 위해 설계되었다.

 기본지침서 (액틴 -F, ATGAAGATCCTTACAGAAAG; 액틴 -R, TCTTGTTTAGAGATCCACAT)를 사용하여 꿀벌

액틴 유전자 (GenBank 수탁 번호 BI504901)의 514 bp를 내부 대조군으로 증폭하기 위해 사용되었다. 

DNA synthesis was performed by using moloney murine leukemia virus reverse transcriptase (Promega) and random primers

in a volume of 20 μl. RNA from bee samples (2 μg) and 0·5 vol. RNA from beehive products (honey, pollen, royal jelly and

brood food) and mite samples was used for cDNA synthesis.

DNA 합성은 moloney murine 백혈병 바이러스 역전사 효소 (Promega)와 20μl 부피의 무작위 프리머를 사용하여

수행되었다. 꿀벌 샘플 (2 μg) 및 0 · 5 vol. 벌집 제품 (꿀, 화분, 로열 젤리 및 유충 음식) 및 응애 샘플의 RNA를

cDNA 합성에 사용했습니다.

PCR was carried out by using a program of initial denaturing for 5 min at 94 °C and 35 cycles of 94 °C for 20 s, 50 °C for 20 s

and 72 °C for 1 min. A 5 μl aliquot of the RT-PCR product was electrophoresed in a 1·5 % agarose gel, stained with ethidium

bromide and imaged by using a Kodak digital-image system.

PCR은 94 °C에서 5분 동안 초기 변성 프로그램을 사용하여 20초 동안 94 °C, 20초 동안 50 °C, 1분 동안 72 ° C의

35주기를 사용하여 수행되었다. RT-PCR 제품의 5μl 부분 표본을 1 · 5 % 아가 로스겔에서 전기 영동하고 브롬화

에티듐 색소로 염색하고 Kodak 디지털 이미지 시스템을 사용하여 이미지화했다.

Fragment sizes were determined relative to a 100 bp DNA ladder (Promega). A negative control lacking template DNA and

a positive cDNA control were performed for each PCR. Data analysis. Student's t-test (statview statistical package, version

5.0.1; SAS Institute Inc.) was used to analyse the data.

단편 크기는 100bp DNA 래더 (Promega)를 기준으로 결정되었다. 원형 DNA가 없는 음성 대조군과 양성 cDNA

대조군을 각 PCR에 대해 수행했다. 데이터 분석 : 학생의 t-test (statview 통계 패키지 버전 5.0.1, SAS Institute

Inc.)를 사용하여 데이터를 분석했다.

RESULTS

결과

Development of immunological methods for KBV detection

KBV 검출을 위한 면역학적 방법 개발

To detect KBV capsid proteins, two regions of the KBV genome, AD and Odt, were selected for expression‎ in a

bacterial-expression‎ system (Fig. 1aF1). By using homologous protease-cleavage sites between VP2 and VP0, VP4 and

VP3, and VP3 and VP1 in viruses of the family Dicistroviridae (Liljas et al., 2002), the cleavage sites of KBV major coat

proteins and VP4 were predicted to yield three major polypeptides (VP1, VP2 and VP3) of 23·8, 29·7 and

33·3 kDa, respectively, and a smaller VP4 (7·1 kDa).

KBV 캡시드 단백질을 검출하기 위해, KBV 게놈의 두 영역인, AD 및 Odt는 박테리아 발현 시스템에서 발현

하도록 선택했다 (그림 1aF1). Dicistroviridae 과의 바이러스에서 VP2와 VP0, VP4 및 VP3, VP3와 VP1

사이의 상동성 단백질 분해 효소 절단 부위를 사용함으로써, KBV 주요 외피 단백질과 VP4의 절단 부위는

3개의 주요 폴리펩타이드(VP1, VP2 및 VP3)가 생성될 것으로 예측되었다. 각각, 23 · 8, 29 · 7 및 33 · 3 ,

그리고 더 작은 VP4 (7 · 1 kDa).

AD contains the region for capsid proteins VP2, VP4 and the N terminus of VP3, whereas Odt contains VP3 and the N

terminus of VP1. Therefore, the two recombinant proteins included all of the major and minor viral-coat proteins

(Liljas et al., 2002; Stoltz et al., 1995). Two recombinant proteins of the predicted sizes (41·7 kDa for AD and 27·7 kDa

for Odt) were expressed in bacteria and purified by using affinity columns (data not shown). Polyclonal rabbit

antibodies were produced against these recombinant proteins.

AD는 캡시드 단백질 VP2, VP4 및 VP3의 N 말단의 영역을 포함하는 반면, Odt는 VP3 및 VP1의 N 말단을

포함한다. 따라서, 두 개의 재조합 단백질에는 모든 주요 및 소수의 바이러스 코트 단백질이 포함되었다

. 예측된 크기의 두 가지 재조합 단백질 (AD의 경우 41 · 7kDa, Odt의 경우 27 · 7kDa)은 박테리아에서

발현하고 친화성 컬럼을 사용하여 정제했다 (데이터는 표시되지 않음). 이러한 재조합 단백질에 대해

다클론성의 토끼 항체가 생산되었다.

To test the specificity of the antibodies, we selected nine samples for the detection of KBV by ELISA and Western blot

(Fig. 2F2). Four of the nine samples were positive for capsid proteins by ELISA using anti-VP4. Similar results were

obtained by Western blot using the three KBV antibodies.

항체의 특이성을 테스트하기 위해, 효소면역측정법 및 특수 단백질 검출 검사로 KBV 검출을 위해 9개의

샘플을 선택했다 (그림 2F2). 9개 샘플 중 4 개는 anti-VP4를 사용하는 효소면역측정법에 의해 캡시드

단백질에 대해 양성이었다. 3 개의 KBV 항체를 사용하여 특수 단백질 검출 검사에 의해 유사한 결과를 얻었다.

As the recombinant proteins Odt and AD corresponded to more than one putative KBV capsid protein, multiple bands

were detected. All of the protein bands detected by anti-AD and anti-Odt antibodies were within the 20–35 kDa size

range, which is in agreement with the predicted sizes of the major coat proteins (Liljas et al., 2002) and is also consistent

with the sizes of the coat proteins detected in purified KBV separated by SDS-PAGE (Stoltz et al., 1995).

재조합 단백질 Odt 및 AD가 하나 이상의 추정 KBV 캡시드 단백질에 해당하므로, 다중 밴드(띠)가 감지되었다.

항-AD 및 항-Odt 항체에 의해 검출된 모든 단백질 밴드는 20–35kDa 크기 범위 내에 있었으며, 이는 주요

코트 단백질의 예상 크기와 일치하며 SDS-PAGE에 의해 분리된 정제 KBV에서 검출된 코트 단백질의 크기에서

또한 일관성이 있다.  

However, anti-AD reacted with VP2 and VP3 but, surprisingly, did not react with VP4. Anti-Odt reacted with VP3 and VP1.

Anti-VP4 reacted with only VP4. The results demonstrated that the three KBV antibodies were specific for KBV capsid

proteins, did not react with bee proteins and did not cross-react with SBV.

그러나, 항-AD는 VP2 및 VP3와 반응했지만, 놀랍게도, VP4와 반응하지 않았다. 항-Odt는 VP3 및 VP1과

반응했다. 항-VP4는 VP4 와만 반응했다. 결과는 세 가지 KBV 항체가 KBV 캡시드 단백질에 특이적이고,

꿀벌 단백질과 반응하지 않았으며 SBV와 교차 반응하지 않았음을 보여주었다.

The low level (<25 %) of amino acid identity between the structural proteins of KBV and SBV, as determined by blast

analysis, may have precluded the cross-reactivity of the antisera.

발아 분석에 의해 결정된 것으로, KBV와 SBV의 구조 단백질 간의 아미노산 동일성의 낮은 수준 (<25 %)은

항혈청의 교차 반응을 배제할 수 있다.

Detection of bee viruses by RT-PCR

RT-PCR에 의한 꿀벌 바이러스 탐지

By using specific primers for two honeybee viruses, we detected KBV and SBV in bee samples by using RT-PCR (Fig. 3F3).

Bee actin primers were used as an internal standard for RT-PCR and also to demonstrate the quality of the RNA. Primers

for KBV, SBV and bee actin were specific and consistently amplified 290, 211 and 514 bp cDNA fragments, respectively.

꿀벌 바이러스 2 종에 특정 프라이머를 사용하여, RT-PCR을 이용하여 꿀벌 샘플에서 KBV와 SBV를 검출했다

(그림 3F3). 꿀벌 단백질 프라이머는 RT-PCR의 내부 표준으로 사용되었으며 또한 RNA의 품질을 입증하기

위해 사용되었다. KBV, SBV 및 꿀벌 단백질에 대한 프라이머는 각각 290, 211 및 514 bp cDNA 조각을

구체적이며 지속적으로 증폭하였다.

Sequencing of the KBV and SBV cDNA fragments verified their respective identities. In addition to the four

bees that were positive for KBV (Fig. 2F2) by immunological detection methods, two more samples tested positive by

RT-PCR (Fig. 3F3). 

KBV 및 SBV cDNA 조각의 서열은 각각의 동일성을 확인했다. 면역학적 검출법에 의해 KBV 양성 (그림 2F2)

인 4 마리의 꿀벌 외에도, RT-PCR에 의해 2개의 샘플이 양성인 것으로 테스트되었다 (그림 3F3). 

To further compare these methods of KBV detection, we injected 16 healthy-appearing bee pupae with extracts of

honeybees that tested positive for KBV infection by ELISA using the anti-VP4 antiserum. In the control group, the

three anti-KBV antisera detected 0–40 % KBV positivity whereas, in the injected group, KBV positivity increased

to >80 % (81·2–93·8 %), suggesting KBV replication in the injected bees (Table 1T1).

이러한 KBV 검출 방법을 추가로 비교하기 위해, 우리는 항-VP4 항혈청을 사용하여 효소면역측정법에 의해

KBV 감염 양성 판정을 받은 꿀벌 추출물을 건강하게 보이는 벌 번데기 16마리에 주입했다. 대조군에서는,

3개의 항 -KBV 항혈청이 0–40 % KBV 양성을 검출된 반면, 주사된 그룹에서는, KBV 양성은> 80 %

(81 · 2–93 · 8 %)로 증가하여, 주입된 꿀벌에서 KBV 복제를 시사한다 (표 1T1).

In contrast, RT-PCR detected the presence of KBV in 100 % of bees in both groups. These results demonstrated that the

healthy-appearing bees had latent viral infection that could be detected more efficiently by RT-PCR than by ELISA.

반대로, RT-PCR은 두 그룹 모두에서 100 %의 꿀벌에서 KBV의 존재를 검출했다. 이러한 결과는 건강한 것으로

보이는 꿀벌이 효소면역측정법 보다 RT-PCR에 의해 더 효율적으로 검출될 수 있는 잠재성 바이러스 감염을

가지고 있음을 입증했다.

Furthermore, even though the sensitivity of the three antisera after viral injection did not differ significantly, their

sensitivity varied in bees with latent infections. It is also noted that, in this bee colony, ∼50 % of the bees had SBV

infections and most, if not all, occurred as KBV/SBV co-infections.

또한, 바이러스 주입 후 세 가지 항혈청의 민감도는 크게 다르지 않았지만, 잠복 감염이있는 꿀벌에서

민감도는 다양했다. 또한 이 꿀벌 봉군에서 벌의 ~ 50 %가 SBV에 감염 되었고, 전부는 아니더라도,

대부분은 KBV / SBV 공동 감염이 발생했다.

Survey of viral preval‎ence in different bee populations

다양한 꿀벌 개체군의 바이러스 발병력 조사

We applied these detection methods for KBV and SBV to 94 bee samples collected in four different apiaries (Table 1T1).

The proportion of ELISA KBV-positive samples ranged from 3·3 to 50 %, and the proportion of RT-PCR KBV-positive

samples ranged from 66·7 to 100·0 %. Except for the Rockspring apiary, all apiaries had high levels of KBV infection

(>94 % RT-PCR positivity) and 41·2–88·9 % SBV infection.

우리는 KBV와 SBV에 대해 이러한 검출 방법을 4 군데 서로 다른 양봉장에서 수집한 94 개의 꿀벌 샘플에

적용했다 (표 1T1). 효소면역측정법 KBV 양성 샘플의 비율은 3 · 3 ~ 50 % 범위였고, RT-PCR KBV 양성

샘플의 비율은 66.7~100.0 % 범위였다. 록스프링 양봉장을 제외한, 모든 양봉장은 높은 수준의 KBV 감염

(> 94 % RT-PCR 양성)과 41.2 – 88.9 % SBV 감염을 나타냈다.

The Rockspring apiary had the lowest level of KBV infection (66·7 %) and no SBV was detected. This survey further

confirmed the presence of viral infections in most apiaries, even though most of the colonies did not show any

viral-disease symptoms.

록스프링 양봉장은 KBV 감염 수준이 가장 낮았으며 (66. 7 %) SBV가 발견되지 않았다. 이 조사는 대부분의

봉군은 어떤 바이러스 질병 증상이 나타나지 않았지만, 대부분의 양봉장에서 바이러스 감염의 존재를 추가로

확인했다.

It further proved that RT-PCR is a more powerful method for KBV detection in honeybees. This survey also revealed the

presence of KBV and SBV co-infections in 38·3 % (36/94) of the tested samples, although the co-infection rates varied

between locations of the apiaries.

게다가 RT-PCR이 꿀벌의 KBV 검출에 더 강력한 방법임을 입증했다. 이 설문 조사는 또한 양봉장의 위치에

따라 공동 감염률이 다르지만, 거ㅁ사 받은 샘플의 38 . 3 % (36/94)에서 KBV 및 SBV 공동 감염의 존재를

보여주었다.

Transmission routes of honeybee viruses

꿀벌 바이러스의 전염 경로

To test whether bee viruses (KBV and SBV) could be transmitted vertically from the queen to the eggs, we collected 21

queens from the 20 colonies and three egg samples from two of these 20 colonies (colonies 216 and 14). Both KBV and

SBV RNA fragments were amplified from queen and egg samples (Table 2T2), indicating that these viruses may be

transmitted from the queen to the eggs via transovarial transmission.

꿀벌 바이러스 (KBV 및 SBV)가 여왕벌에서 알로 수직으로 전파될 수 있는지 테스트하기 위해, 우리는 20개의

봉군에서 21마리의 여왕벌과 이 20개의 봉군 중 2군 (컬봉군216 및 14)에서 3개의 알 샘플을 수집했다.

KBV와 SBV RNA 조각은 여왕벌과 알 샘플에서 증폭하였고 (표 2T2), 이러한 바이러스가 경란 전염을 통해

여왕벌에서 알로 전염될 수 있다는 것을 나타낸다.

KBV RNA was amplified in 71·4 % (15/21) of the queens and SBV RNA was amplified in 61·9 % (13/21) of the queens,

indicating that the majority of queens had KBV and SBV co-infections. As several of the queens were known to be 2 years

old, viral infections might not have affected their longevity.

KBV RNA는 여왕의 71. 4 % (15/21)에서 증폭되었고 SBV RNA는 여왕의 61. 9 % (13/21)에서 증폭되었으며,

이는 대부분의 여왕벌이 KBV와 SBV 공동 감염되었다는 것을 나타낸다. 여왕벌 중 일부는 2년된 것으로 알려졌기

때문에, 바이러스 감염이 그들의 수명에 영향을 주지 않았을 수 있다.

Given the role of workers in providing for and feeding the colony, we asked whether the food itself could be a route of

viral transmission. The two colonies (14 and 216) tested have a high preval‎ence of KBV and SBV detected by RT-PCR

(100 % KBV-positive, 81·8–90 % SBV-positive) (Table 3T3). This result suggests that worker bees may be partially

responsible for the horizontal transmission of both viruses in bee colonies.

봉군을 부양하고 먹이를 주는 일벌의 역할을 감안할 때, 우리는 음식 자체가 바이러스 전염 경로가 될 수

있는지 물었다. 테스트한 2개의 봉군 (14 및 216)은 RT-PCR에 의해 검출된 KBV 및 SBV의 높은 발병률을

나타낸다 (100 % KBV 양성, 81.8 – 90 % SBV 양성) (표 3T3). 이 결과는 일벌이 꿀벌 봉군에서 두 바이러스의

수평 전염에 부분적으로 책임이 있음을 시사한다.

From these two colonies, we tested several food sources that contain hypopharyngeal- or mandibular-gland

secretions for the presence of the two viruses by RT-PCR. In our study, 33·3–80·0 % of the food sources tested

were positive for KBV and 50·0–100·0 % of these food sources tested positive for SBV (Table 3T3). In these food

sources, co-occurrence of KBV and SBV ranged from 33·3 to 75·0 %.

이 두 봉군에서, RT-PCR로 두 바이러스의 존재에 대해 하인두 또는 하악선 분비물을 포함하는 여러

식량 재료를 테스트했다. 우리의 연구에서, 테스트한 식량 재료의 33. 3 – 80. 0 %는 KBV에 대해 양성

이었고 이들 식량 자원의 50. 0–100. 0 %는 SBV에 대해 양성이었다 (표 3T3). 이러한 식량 자원에서,

KBV와 SBV의 동시 발생률은 33. 3 ~ 75. 0 % 범위였다.

Bee actin was present in two of five samples of brood food, suggesting that cells from a honeybee were present.

Perhaps cell sloughing was occurring in either the worker mandibular glands or in the larva itself. This result suggests

that worker bees may be transmitting viruses to larvae or other adult bees via these secretions.

꿀벌 액틴(근육 단백질)은 5개의 유충 식량 샘플 중 2개에 존재하였고, 이는 꿀벌의 세포가 존재했음을

시사한다. 아마도 일벌 하악선이나 유충 자체에서 세포가 벗겨지는 현상이 발생했을 것이다. 이 결과는

일벌이 이러한 분비물을 통해 유충이나 다른 성충에게 바이러스를 전염시킬 수 있음을 시사합니다.

Varroa mites potentially vector KBV and SBV during parasitization of bees Varroa mites feed on the haemolymph of

the developing pupae and the adult bees. Female mites enter the brood cells at the end of larval stages and secrete

saliva into the host during feeding.

바로아 응애는 꿀벌에 기생하는 동안 잠재적으로 KBV 및 SBV를 매개한다. 바로아 응애는 진화하는 번데기

와 성봉의 혈림프를 빨아 먹는다. 암컷 응애는 유충 단계가 끝날 무렵에 유충방으로 들어가 먹이를 먹는

동안 숙주로 타액을 분비한다.

This is a potential transmission route for the bee viruses. Mites were collected from the adults or pupae of bees in

colony 14. Both KBV and SBV RNAs and KBV viral proteins were detected in mite samples (Fig. 4F4). Viral RNA

could be detected in single mites (Fig. 4aF4). However, the presence of these viruses was variable in mite samples

taken from a single colony, indicating that not all mites had the viruses.

이것은 꿀벌 바이러스의 잠재적인 전염 경로이다. 응애는 봉군 14에 있는 성봉 또는 벌 번데기에서 수집

되었다. 응애 샘플에서 KBV 및 SBV RNA와 KBV 바이러스 단백질이 모두 검출되었다 (그림 4F4).

바이러스성의 RNA는 단일 응애에서 검출될 수 있다 (그림 4aF4). 그러나, 이러한 바이러스의 존재는

단일 봉군에서 채취한 응애 샘플에서 일정하지 않아 모든 응애는 바이러스가 있지 않다는 것을 나타낸다.

KBV was detected in more of the mite samples than SBV. For ELISA, the levels of detected KBV capsid proteins were

significantly different between mites and ELISA buffer control (P=0·002, pairwise Student's t-test) (Fig. 4bF4). The

direct evidence for the ability of the mites to vector the viruses was the detection of KBV in mite saliva.

KBV는 SBV보다 응애 샘플에서 더 많이 검출되었다.  효소면역측정법의 경우에, 검출된 KBV 캡시드

단백질의 수준은 응애와 효소면역측정법 완충제 대조군간에 상당하게 달랐다 (P = 0 · 002, 쌍으로 학생의

t- 실험) (그림 4bF4). 응애가 바이러스를 매개하는 능력에 대한 직접적인 증거는 응애 타액에서 KBV의

검출이었다.

These mites were taken from colony 14 in the Penn State apiary, which had known KBV and SBV infections. The levels

of KBV capsid proteins were significantly different between mite saliva and medium alone (P=0·039, pairwise Student's

t-test) (Fig. 4bF4), indicating the presence of KBV in the mite secretions.

이 응애는 KBV 및 SBV 감염이 알려진 펜실베니아 주 양봉장의 봉군 14에서 가져왔다. KBV 캡시드 단백질의

수준은 진드기 타액과 배지 단독 (P = 0 · 039, pairwise Student 's t-test) 사이에서 상당하게 달랐으며,

이는 응애 분비물에 KBV가 존재한다는 것을 나타낸다.

DISCUSSION

토론

Diagnosis of KBV and SBV based on observed symptoms is not dependable, as honeybees infected with KBV and SBV 

have no reliable symptoms. Developing specific methods for the detection of KBV infection is important. We have

compared ELISA and RT-PCR for detection of KBV infection in bees.

KBV 및 SBV에 감염된 꿀벌은 확실한 증상이 없기 때문에, 관찰된 증상에 따른 KBV 및 SBV의 진단은 신뢰할

수는 없다. KBV 감염을 검출하기 위한 구체적인 방법을 개발하는 것은 중요하다. 꿀벌의 KBV 감염 검출을

위해 효소면역측정법과 RT-PCR을 비교했다.

All three KBV antibodies, which were specific for capsid proteins, did not react with bee proteins and did not cross-react

with SBV. The results of our experiments have shown consistently that RT-PCR was much more sensitive than ELISA, and

RT-PCR was the method of choice for detecting viral infections.

캡시드 단백질에 특이성의 세 가지 KBV 항체는 모두 꿀벌 단백질과 반응하지 않았고 SBV와 교차 반응도 하지

않았다. 우리의 실험 결과는 RT-PCR이  효소면역측정법 보다 훨씬 더 민감하고, RT-PCR이 바이러스 감염을

검출하기 위한 선택 방법이라는 것을 일관되게 보여주었다.

Especially in the survey study, the overall percentage of KBV positivity (87·2 %) was much higher than that from the ELISA

method (20·2–23·8 %). In our studies, all tested samples that had viral capsid proteins as detected by ELISA were

positive by RT-PCR, but most bees without capsid proteins tested positive by RT-PCR.

특히 조사 연구에서, KBV 확실함 (87. 2 %)의 전체 백분율이 효소면역측정법 방법 (20 . 2 ~ 23 . 8 %)보다

훨씬 높았다. 우리의 연구에서, 효소면역측정법에 의해 검출된 바이러스성 캡시드 단백질이 있는 모든 테스트

샘플은 RT-PCR에 의해 양성이었지만, 캡시드 단백질이 없는 대부분의 꿀벌은 RT-PCR에 의해 양성으로

테스트되었다.

Some samples with very high KBV RNA levels as detected by RT-PCR were negative by ELISA. The detection of low levels

of viral-capsid proteins by ELISA may indicate that these healthy-appearing bees have low levels of viral infection.

Alternatively, KBV may potentially be latent or persistent in a bee as a viral genome with extremely low levels of

viral-capsid proteins.

RT-PCR에 의해 검출된 매우 높은 KBV RNA 수준을 가진 일부 샘플은 효소면역측정법에 의해 음성이었다.

효소면역측정법에 의한 낮은 수준의 바이러스성 캡시드 단백질의 검출은 이렇게 건강하게 보이는 꿀벌이

낮은 수준의 바이러스 감염을 가지고 있다고 나타낼 수 있다. 대안적으로, KBV는 잠재적으로 매우 낮은

수준의 바이러스 캡시드 단백질을 가진 바이러스 게놈으로서 꿀벌에서 잠복하거나 지속될 수 있다.

We hypothesized that bee viruses (KBV and SBV) can be vectored by varroa mites and transmitted by both vertical-

and/or horizontal-transmission routes among honeybees (Fig. 5F5). Anderson (1985) suggested that KBV could be

transmitted by other means, as KBV was reported in Canada before the introduction of varroa mites to that country.

우리는 꿀벌 바이러스 (KBV 및 SBV)가 바로아 응애에 의해 매개될 수 있고 꿀벌 간 수직 및 / 또는 수평

전염 경로를 통해 전염 될 수 있다고 가정했다 (그림 5F5). 앤더슨 (1985)은 캐나다에 바로아 응애가

도입되기 전에 KBV가 캐나다에서 보고 되었기 때문에, KBV가 다른 방법으로 전파될 수 있다고 암시하였다.

Our results demonstrated that bee viruses (KBV and SBV) could potentially be transmitted either vertically from the

queen to the eggs via transovarial transmission, or horizontally from workers to larvae or other bees via food sources

containing glandular secretions. KBV and SBV were detected in both queens and eggs by RT-PCR, which indicates

a route of transovarial transmission.

우리의 결과는 꿀벌 바이러스 (KBV 및 SBV)가 경란 전염을 통해 여왕에서 알로 수직으로 전염되거나,

선 분비물을 포함하는 음식 재료를 통해 일벌에서 유충 또는 다른 꿀벌에게 수평으로 전염될 수 있음을

보여 주었다. KBV와 SBV는 RT-PCR에 의해 여왕과 난자 모두에서 발견되었으며, 이는 경란 전염의 경로를

나타낸다.

Previously, Hung (2000) detected KBV in the faecal materials of worker and queen bees. In his experiment, queens were

confined individually in separate Petri dishes. The faecal material was collected from each queen with a micropipette as

soon as they defecated. In this experiment, one out of three queen excreta was positive by RT-PCR, suggesting that KBV

was present in queens and that other bees could become infected when cleaning the hive.

이전에, Hung (2000)은 일벌과 여왕벌의 배설물에서 KBV를 발견했다. 그의 실험에서, 여왕은 별도의 페트리

접시에 개별적으로 갇혔다. 대변 물질은 배설하자마자 마이크로파이펫으로 각 여왕벌로부터 수집되었다.

이 실험에서, 여왕벌 배설물 3개 중 1개는 RT-PCR에 의해 양성으로 나타났으며, 이는 KBV가 여왕벌에 존재

하고 다른 꿀벌이 벌통을 청소할 때 감염될 수 있음을 시사한다.

Bee viruses (KBV and SBV) can potentially be transmitted horizontally via worker secretions. Our study demonstrated

that bee viruses (KBV and SBV) were detected in worker bees, brood food, honey, pollen and royal jelly. These bee

viruses may be transmitted from worker bees to larvae or to other adult bees (queen, other workers or drones) via

food resources in the colony.

꿀벌 바이러스 (KBV 및 SBV)는 작업자 분비물을 통해 수평으로 전염될 수 있다. 우리의 연구는 꿀벌

바이러스 (KBV 및 SBV)가 일벌, 유충 음식, 꿀, 화분 및 로열 젤리에서 발견되었음을 보여 주었다. 이 벌

바이러스는 일벌에서 유충으로 또는 다른 성봉 (여왕벌, 다른 일벌 또는 수벌)에게 봉군의 식량 자원을

통해 전염될 수 있다.

It is also possible that bee viruses might be transmitted among colonies by feeding bees the honey or pollen gathered

from diseased colonies (Fig. 4F4). This is a practice used by some beekeepers to help colonies survive during times of

low flowering. Also, dead or weakened colonies can be raided by worker bees from other colonies and honey and

pollen taken back to their colonies.

병든 봉군에서 채취한 꿀이나 화분을 꿀벌에게 먹이면 벌 바이러스가 봉군간에 전염될 수도 있다 (그림 4F4).

이것은 일부 양봉인 무밀기에 봉군이 생존하도록 돕기 위해 사용하는 관행이다. 또한, 죽거나 약해진 봉군은

다른 봉군의 일벌에 의해 습격을 당하고 꿀과 화분을 자기의 봉군으로 가져갈 수 있다.

The importance of these food sources in viral transmission between colonies needs to be defined. Support for food

being a route of transmission comes from studies done by Bailey (1969), who injected SBV preparations into adult

bees and fed SBV to larvae, and then detected viruses in different tissues (head, abdomen, midgut and hypopharyngeal

glands) by immunodiffusion.

봉군 간의 바이러스 전염에서 이러한 식량 자원의 중요성을 정의해야 할 필요가 있습니다. 전염의 경로가

되는 식량 자원에 대한 도움이 되는 것은 베일리 (1969)가 수행한 연구에서 비롯된다. 베일리 (1969)는

SBV 표본을 성봉에 주입하고 SBV를 유충에게 먹이고, 그러고 나서, 면역 확산을 통해 다른 조직 (머리,

복부, 중장 및 하인두 분비선)에서 바이러스를 발견했다. .

This experiment demonstrated virus in the hypopharyngeal glands of bees that had been injected with or fed SBV.

The results also showed that more SBV accumulated in the heads of infected bees than in other regions.

As pointed out by Bailey et al. (14), adult bees detect and remove larvae with sacbrood within a day or two after

the larvae die, while the virus is still infectious.

이 실험은 SBV를 주입하거나 급이한 꿀벌의 하인두 분비선에서 바이러스를 입증했다. 결과는 다른 부위

보다 감염된 꿀벌의 머리에서 더 많은 SBV가 축적되었음을 또한 보여주었다. .

베일리 외 연구진(14)이 지적한 바와 같이, 성봉은 유충이 죽은 후 하루나 이틀 이내에 낭충병에 걸린 유충을

탐지하여 제거하였는데도, 바이러스는 여전히 전염이 된다.

Therefore, SBV is probably transmitted to the adults, as they can be infected by ingesting parts of dead larvae

(especially ecdysial fluid). In turn, they resume feeding the larvae with secretions from their hypopharyngeal glands,

thereby spreading the virus to other bees.

따라서, SBV는 죽은 유충의 일부 (특히 탈피액체)를 섭취하여 감염될 수 있기 때문에, 성봉에게 전염될

수 있다. 다음에는, 그들은 하인두 분비선에서 나온 분비물로 유충에게 먹이 주는 것을 재개하여, 그것

때문에 다른 꿀벌에게 바이러스를 퍼뜨린다.

KBV and SBV can be detected simultaneously in an individual honeybee. Both viral RNAs could be amplified in the

different developmental stages of bees, such as eggs, larvae, pupae and adults of queens, workers and drones.

About half of the bee samples (69/139) had both KBV and SBV in the same bee, suggesting that these viruses

could infect the same honeybee simultaneously, with both viruses being detected at high levels.

개별 꿀벌에서 KBV와 SBV를 동시에 발견할 수 있다. 두 바이러스성 RNA는 알, 유충, 번데기 및 여왕벌,

일벌 및 수벌의 성봉과 같은, 꿀벌의 다른 진화 단계에서 확대될 수 있다. 벌 샘플의 약 절반 (69/139)은

동일한 벌에서 KBV와 SBV를 모두 가지고 있었으며, 이는 이 바이러스가 동일한 꿀벌을 동시에 감염시킬

수 있으며, 두 바이러스 모두 높은 수준에서 검출될 수 있음을 시사한다.

Based upon serological tests, Anderson & Gibbs (1988) reported simultaneous, unapparent infections of KBV,

SBV and Black queen cell virus (BQCV). When activated, KBV was thought to suppress the replication of SBV

and BQCV. However, we did not observe this. In addition, Dall (1985) reported that there was no instance of

mixed infection of KBV and SBV in bees in Australia.

혈청학적 검사를 기반으로, 앤더슨 & 깁스 (1988)는 KBV, SBV 및 BQCV (검은 왕대 바이러스)의

동시다발적이고 명백하지 않은 감염을 보고 했다. 활성화 되면, KBV는 SBV 및 BQCV의 복제를

억제하는 것으로 생각되었다. 그러나, 우리는 이것을 관찰하지 않았다. 또한, 데일 (1985)은 호주 꿀벌

에서 KBV와 SBV의 혼합 감염 사례가 없다고 보고했다.

The reason for this discrepancy may lie in the difference of sensitivity of the virus-detection methods. Varroa mites

can be vectors for KBV and SBV. The worldwide spread of varroa mites in honeybee colonies has had a significant

influence on viral infections in bees (Bakonyi et al., 2002).

이러한 차이의 원인은 바이러스 검출 방법의 감수성(예민함)의 차이 때문일 수 있다. 바로아 응애는 KBV

및 SBV의 매개체가 될 수 있다. 꿀벌 봉군에서 전세계적으로 퍼진 바로아 응애는 꿀벌의 바이러스 감염에

상당한 영향을 미쳤다.

In Britain, before the invasion of the varroa mite, Acute bee paralysis virus (ABPV) never caused bee mortality whereas,

after the invasion, bee mortality increased due to ABPV (Allen et al., 1986; Batuev, 1979). Allen et al. (1986) and

Batuev (1979) suggested that varroa was associated with ABPV. By using immunodiffusion tests, Ball & Allen (1988)

compared the preval‎ence of bee viruses in dead-bee samples from colonies infested with varroa mites with bees in

uninfested colonies.

영국에서는, 바로아 응애가 침입하기 전에, 급성 벌 마비 바이러스 (ABPV)가 대규모 사망을 유발한 적이

없었는데 반하여, 침입 후는, ABPV로 인해 대규모 사망이 증가했다. 알렌 외(1986) 및 바투에프 (1979)는

바로아가 ABPV와 관련이 있다고 시사했다. 면역 확산 테스트를 사용하여, 볼 & 알렌 (1988)은 바로아

응애로 들끓는 봉군에서 죽은 벌 샘플의 벌 바이러스 발병률을 들끓지 않은 봉군의 꿀벌과 비교했다.

The results demonstrated that ABPV titres were significantly higher in bee samples with varroa mites. They suggested

that ABPV was the primary cause of adult bee mortality in honeybee colonies infested severely with Varroa jacobsoni.

The authors suggested that the varroa mite potentially activated ABPV replication in adult bees by its feeding

behaviour and potentially transmitted the virus from adult bees to pupae (Ball, 1983; Ball & Allen, 1988).

결과는 ABPV 역가가 바로아 응애가 있는 꿀벌 샘플에서 상당하게 더 높다는 것을 보여 주었다. 그들은

ABPV가 바로아 제콥소니에 심하게 들끓는 꿀벌 봉군에서 성봉 대규모 사망의 주요 원인이라고 시사했다.

저자는 바로아 응애가 먹이 행동에 의해 성봉에서 잠재적으로 ABPV 복제를 활성화하고 잠재적으로

성봉에서 부터 번데기 까지 바이러스가 전염된다고 시사했다.

In a review, Bailey & Ball (1991) suggested the possibility that varroa mites may transmit KBV in the same manner

as they do ABPV. Hung & Shimanuki (1999) and Hung et al. (2000) detected KBV in varroa mites by using RT-PCR.

In our study, we have demonstrated that KBV and SBV can be detected simultaneously in varroa mites.

평가에서, 베일리 & 볼 (1991)은 바로아 응애가 ABPV를 전염시킨 동일한 방식으로 KBV를 전염할 수

있다는 가능성을 시사했다. 훙 & 시마누키 (1999) 및 훙 외 (2000)는 RT-PCR을 사용하여 바로아

응애에서 KBV를 검출했다. 우리의 연구에서, 우리는 바로아 응애에서 KBV와 SBV가 동시에 검출될

수 있음을 입증했다.

Moreover, our detection of KBV capsid proteins in varroa-mite saliva suggests that varroa mites may potentially

vector KBV via their saliva. Therefore, varroa mites may transmit viruses to bees during feeding. Also, RNAs of KBV

and SBV can be detected in mites, even in single mites, indicating that the mites may also be infected with the virus.

더욱이, 바로아-응애 타액에서 KBV 캡시드 단백질의 발견은 바로아 응애가 타액을 통해 잠재적으로 KBV를

매개할 수 있음을 시사합니다. 따라서, 바로아 응애는 먹이를 먹는 동안 벌에게 바이러스를 전염시킬 수

있다. 또한, KBV 및 SBV의 RNA는 응애, 한마리 응애에서도 검출될 수 있어, 응애가 바이러스에 감염될

수 있다는 것을 나타낸다.

The intensity of this reaction suggested that the virus was present at high levels and was not just found in mouthparts

or the digestive tract. More recently, increasing knowledge of the interactions between honeybee viruses and

parasitic mites (varroa mites and tracheal mites) has led to the suggestion that interactions may underlie honeybee

mortality and colony collapse (Allen et al., 1986; Batuev, 1979; Brødsgaard et al., 2000; Korpela et al., 1992).

이 반응의 강도는 바이러스가 높은 수준으로 존재하고 구기(口器 ; 입틀)나 소화관에서 발견되는 것만

않니다라는 것을 시사했다. 더 최근에 꿀벌 바이러스와 기생 응애 (바로아 응애 및 기문 응애) 간의

상호 작용에 대한 지식이 증가함에 따라 상호 작용이 꿀벌 대규모 사망과 봉군 붕괴의 기초가 될 수

있다는 제안으로 이어졌다.

To date, this relationship between the mite infestation and viral infection is not clearly understood. Also, there is

little support for an increased SBV infection with varroa-mite infestation in adult bees.

현재까지, 응애 만연과 바이러스 감염 사이의 이러한 관계는 명확하게 이해되지 않았다. 또한, 성봉에서

바로아 응애 만연으로 인한 SBV 감염 증가에 대한 도움이 되는 것은 거의 없다.

Our research has provided direct evidence for the role of varroa in vectoring bee viruses (KBV and SBV). In addition,

we are testing the role of varroa mites in inducing viral infections in bees, and examining the interaction of these

viruses and mite tissues.

우리의 연구는 꿀벌 바이러스 (KBV 및 SBV) 매개에서 바로아의 역할에 대한 직접적인 증거를 제공했다.

또한, 벌의 바이러스 만연을 유도하는데 있어 바로아 응애의 역할을 테스트하고, 이러한 바이러스와 응애

조직의 상호 작용을 조사하고 있다.

Fig. 1.Schematic diagram of the genomes of KBV (a) and SBV (b).

그림 1. KBV (a) 및 SBV (b)의 게놈 개략도. 

Open boxes represent open reading frames (ORFs). The nucleotide positions at the beginning and end of each ORF are

indicated above the ORFs. Regions of the genome proposed to encode a helicase, protease and RNA-dependent RNA

polymerase (RdRp) are indicated.

열린 상자는 열린 판독 프레임 (ORF)을 나타낸다. 각 ORF의 시작과 끝에 있는 뉴클레오티드 위치는 ORF

위에 표시 된다. 나선 효소, 단백질 분해 효소 및 RNA-의존 RNA 중합효소 (RdRp)를 암호화하도록 제안된

게놈 영역이 표시된다.

 주) nucleotide ; 핵산의 구성 성분

The primers used for RT-PCR (KBV-F and KBV-R, SBV-F and SBV-R) and two expressed KBV proteins are indicated.

The predicted sizes and coding regions of KBV capsid proteins are indicated by arrows, along with the predicted

N-terminal sequence of each protein and its upstream amino acid residue.

RT-PCR에 사용되는 프라이머 (KBV-F 및 KBV-R, SBV-F 및 SBV-R)와 두 개의 발현 된 KBV 단백질이

표시됩니다. KBV 캡시드 단백질의 예측 된 크기 및 코딩 영역은 각 단백질의 예측 된 N- 말단 서열 및

그것의 업스트림 아미노산 잔기와 함께 화살표로 표시됩니다.

Fig. 1.

그림 1

Fig. 2.Detection of KBV proteins in bees by using anti-KBV antibodies

그림 2. 항-KBV 항체를 이용한 꿀벌의 KBV 단백질 검출.

Samples represent healthy-appearing bees. KBV positivity by ELISA was confirmed by anti-VP4 antiserum, whereas

the RT-PCR positivity of SBV and KBV was used to indicate the presence of viral RNAs in the samples.

샘플은 건강하게 보이는 꿀벌을 나타낸다. 효소면역측정법에 의한 KBV 양성은 항 -VP4 항혈청으로

확인된 반면, SBV 및 KBV의 RT-PCR 양성은 샘플에서 바이러스 RNA의 존재를 나타내는데 사용되었다.

The gel was stained with Coomassie blue (a) and the proteins were probed with antiserum against AD (b), Odt (c)

or VP4 (d). Lanes: 1, worker pupa; 2 and 3, drone larvae; 4 and 5, uninjected pupae; 6–9, KBV-injected pupae.

겔은 쿠마시 블루 (a)로 염색하고 단백질을 AD (b), Odt (c) 또는 VP4 (d)에 대한 항혈청으로 조사했다.

레인 : 1, 일벌 번데기; 2 및 3, 수벌 유충; 4 및 5, 주사되지 않은 번데기; 6–9, KBV 주사 번데기.

Fig. 2.
그림 2

Fig. 3.RT-PCR detection of bee viruses.

그림 3. 꿀벌 바이러스의 RT-PCR 탐지. 

The same samples as in Fig. 2F2 were tested by RT-PCR using KBV- and SBV-specific primers (lanes 1–9). RT-PCR

of bee actin was included as an internal control for the quality of bee RNAs. P, PCR-positive control using cloned

KBV and SBV RT-PCR products; N, no template DNA in the reaction as negative control.

그림 2F2에서와 동일한 샘플을 KBV 및 SBV 특정 프라이머 (레인 1-9)를 사용하여 RT-PCR로 테스트했다.

꿀벌 액틴의 RT-PCR은 꿀벌 RNA의 품질에 대한 내부 대조군으로 포함되었다. 복제된 KBV 및 SBV

RT-PCR 제품을 사용하여 P, PCR 양성 대조군; N, 음성 대조군으로 반응에 주형 DNA 없슴.

Fig. 3.
그림 3

Fig. 4.Detection of the RNAs of KBV and SBV and capsid proteins of KBV in varroa mites. (a) Both KBV and SBV RNAs

were detected in samples with different numbers of mites (one, two, four or 12) by RT-PCR.

N, No-template negative control for RT-PCR. (b) KBV capsid proteins were detected by ELISA in varroa mites (n=9, 12

mites in each sample) and mite saliva collected via mite feeding on an artificial membrane (n=2, each sample was

collected from 20–25 mites over 24 h).

그림 4. 바로아 응애에서 KBV와 SBV의 RNA와 KBV의 캡시드 단백질의 검출. (a) KBV 및 SBV RNA는

RT-PCR에 의해 서로 다른 수의 응애 (1, 2, 4 또는 12)를 가진 샘플에서 검출되었다. N, RT-PCR에 대한

모형 음성 대조군 없슴. (b) KBV 캡시드 단백질은 바로아 응애 (각 샘플에서 n =9, 12 마리의 응애)에서

효소면역측정법으로 검출되었으며, 인공막 위의 응애 먹이를 통해 수집된 응애 타액 (n=2, 각 샘플은 

24 시간 이상 20 ~ 25 마리 응애에서 수집되었다. ).

Fig. 4.
그림 4

Fig. 5.Potential multiple infection routes for bee viruses (KBV and SBV).

그림 5. 꿀벌 바이러스 (KBV 및 SBV)에 대한 잠재적 다중 감염 경로.

KBV and SBV may be transmitted from queens to eggs via vertical transmission, or from workers to larvae or other

bees via secretions. Varroa mites may also transmit viruses to bees during feeding.

KBV 및 SBV는 수직 전염을 통해 여왕벌에서 알로, 또는 분비물을 통해 일벌에서 유충 또는 다른 벌로

전염이 될 수 있다. 바로아 응애는 또한 먹이를 먹는 동안 벌에게 바이러스를 전염 시킬 수 있다.

Fig. 5.

그림 5

Table 1.

표 1

Comparison of KBV and SBV infection rates in injected/uninjected pupae and 94 bee samples from four different

apiaries from summer and autumn 2002 Ninety-four samples belonging to different stages and castes of bees were

from four different apiaries (AP, Airport; HT, Hilltop; PS, Penn State; RSP, Rockspring).

2002년 여름과 가을에 4개의 다른 양봉장에서 얻은 94개의 벌 샘플과 주입 / 미주입된 번데기에서

KBV와 SBV 감염률 비교 (AP, 공항; HT, 힐탑; PS, 펜실베니아 주; RSP, 록스프링).

Individual bees were divided in half and assayed simultaneously for KBV RNA by RT-PCR and capsid proteins by

ELISA using three antisera (anti-Odt, anti-AD and anti-VP4). na, Not assayed.

개별 꿀벌을 반으로 나누고 RT-PCR에 의해 KBV RNA에 대해 동시에 그리고 세 가지 항혈청 (항-Odt,

항-AD 및 항-VP4)을 사용하여 효소면역측정법에 의해 캡시드 단백질에 대해 분석했다. na, 분석되지 않음.

Table 1.Comparison of KBV and SBV infection rates in injected/uninjected pupae and 94 bee samples from four

different apiaries from summer and autumn 2002

표 1. 2002년 여름과 가을부터 4개의 다른 양서류에서 주입/주입되지 않은 번데기와 94개의 벌 표본의

KBV와 SBV 감염률 비교 

Ninety-four samples belonging to different stages and castes of bees were from four different apiaries (AP, Airport;

HT, Hilltop; PS, Penn State; RSP, Rockspring)

꿀벌의 다른 단계와 계급에 속하는 94 개의 샘플은 4 개의 다른 양봉장에서 왔다 (AP, 공항; HT, 힐탑,

PS, 펜실베니아 주, RSP, 록스프링).

Individual bees were divided in half and assayed simultaneously for KBV RNA by RT-PCR and capsid proteins by ELISA

using three antisera (anti-Odt, anti-AD and anti-VP4). na, Not assayed. Group Sample (n) KBV-positive by ELISA (%)

KBV-positive by RT-PCR (%) SBV-positive by RT-PCR (%) Co-infection (KBV and SBV) (%)Anti-VP4 Anti-Odt Anti-AD

개별 꿀벌을 반으로 나누고 RT-PCR에 의해 KBV RNA에 대해 동시에 그리고 세 가지 항혈청 (anti-Odt,

anti-AD 및 anti-VP4)을 사용하여  효소면역측정법에 의해 캡시드 단백질에 대해 분석했다. na, 분석되지

않음. 그룹 샘플 (n) 효소면역측정법에 의한KBV-양성 (%)  RT-PCR에 의한 KBV-양성 (%)  RT-PCR에

의한 SBV-양성 (%) 공동 감염(KBV and SBV) (%) 항 -VP4 항-Odt 항-AD

Injected pupae	16	87·5	81·2	93·8	100	50·0	50·0
Uninjected pupae	15	0	6·7	40·0	100	46·7	46·7
AP apiary	17	23·5	50·0	na	94·1	41·2	41·2
HT apiary	9	33·3	22·2	11·1	100·0	88·9	88·9
PS apiary	38	28·9	37·8	23·7	97·4	57·9	55·3
RSP apiary	30	3·3	3·3	na	66·7	0	0

Table 2.

표 2

Vertical transmission of bee viruses (KBV and SBV) from the queen to the eggs

여왕벌에서 알 벌 바이러스(KBV 및 SBV)의 수직 전염 

Anti-VP4 was used in ELISA tests.

The numberof samples that were positive out of the total number tested is shown in parentheses. na, Not assayed

항 VP4가  효소면역측정법 테스트로 사용되었다.

테스트된 전체 수 중의 양성인 샘플 수는 괄호 안에 표시됩니다. na, 분석되지 않음

Table 2.Vertical transmission of bee viruses (KBV and SBV) from the queen to the eggs

표 2. 여왕에서 알로 꿀벌 바이러스 (KBV 및 SBV)의 수직 전파

Anti-VP4 was used in ELISA tests. The number of samples that were positive out of the total number tested is

shown in parentheses. na, Not assayed. Stage KBV-positive by: SBV-positive by RT-PCR Co-infection of KBV and

SBVELISA RT-PCR

Anti-VP4는 효소면역측정법 테스트에 사용되었다. 테스트된 전체 수 중의 양성인 샘플 수는 괄호 안에

표시된다. na, 분석되지 않음. 단계 KBV 양성 : RT-PCR에 의한 SBV 양성 KBV 및 SBVELISA RT-PCR의

공동 감염

Queen adults	19·0 % (4/21)	71·4 % (15/21)	61·9 % (13/21)	61·9 % (13/21)
Eggs*	na	66·7 % (2/3)	66·7 % (2/3)	66·7 % (2/3)

Table 3.

표3

Detection of bee viruses (KBV and SBV) in bee food sources and workers (adults and larvae) by RT-PCR

RT-PCR을 통해 벌 식량 재료 및 일벌 (성봉 및 유충)에서 벌 바이러스 (KBV 및 SBV) 검출

Bee food sources and workers (adults and larvae) were isolated from two colonies in different apiaries independent

from each other. The number of samples that were positive out of the total number tested is shown in parentheses.

벌 식량 재료와 일벌 (성봉 과 유충)은 서로 독립적인 양봉장에 있는 두 개의 봉군에서 분리되었다.

테스트된 전체 수 중 양성인 샘플 수는 괄호 안에 표시 된다.

Table 3.Detection of bee viruses (KBV and SBV) in bee food sources and workers (adults and larvae) by RT-PCR

표 3. RT-PCR에 의한 벌 식량 재료 및 일벌 (성봉 및 유충)에서 꿀벌 바이러스 (KBV 및 SBV) 검출

Bee food sources and workers (adults and larvae) were isolated from two colonies in different apiaries independent

from each other. The number of samples that were positive out of the total number tested is shown in parentheses.

Sample KBV-positive SBV-positive Concurrence

꿀벌 식량 재료와 일봉 (성봉과 유충)은 서로 독립적인 양봉장에 있는 두 개의 봉군에서 분리되었다.

테스트한 전체 수 중 양성인 샘플 수는 괄호 안에 표시된다. 샘플 KBV 양성 SBV 양성 동시발생

Bee products
Honey	75·0 % (3/4)	75·0 % (3/4)	75·0 % (3/4)
Pollen	33·3 % (1/3)	100·0 % (3/3)	33·3 % (1/3)
Royal jelly	50·0 % (1/2)	50·0 % (1/2)	50·0 % (1/2)
Brood food	80·0 % (4/5)	80·0 % (4/5)	60·0 % (3/5)
Honeybees
Worker adults	100·0 % (10/10)	90·0 % (9/10)	90·0 % (9/10)
Worker larvae	100·0 % (11/11)	81·8 % (9/11)	81·8 % (9/11)

ACKNOWLEDGMENTS

감사의 말씀

We would like to thank Dr Xiaolong Yang for providing the mite saliva and Dr Joachim de Miranda for advice and

help in recombinant protein expression‎. We thank Dr Scott Camazine for his great help in the initiation of the

project and Owen Thompson for technical assistance. We are grateful to Dr Don Stoltz for providing the anti-VP4

antibody. We also thank Drs Craig Cameron and Fred Gildow for critical review of the manuscript. This work was

supported by a grant from the Pennsylvania Department of Agriculture.

응애 타액을 제공한 Xiaolong Yang 박사와 재조합 단백질 발현에 대한 조언과 도움을 주신

Joachim de Miranda 박사에게 감사드립니다. 프로젝트 시작에 큰 도움을 주신 Scott Camazine 박사와

기술 지원에 대해 Owen Thompson에게 감사드립니다. Anti-VP4 항체를 제공해 주신 Don Stoltz 박사

에게 감사드립니다. 또한 원고를 비판적으로 검토한 Craig Cameron 박사와 Fred Gildow 박사에게도

감사드립니다. 이 작업은 펜실베니아 농무부의 보조금으로 지원되었습니다.

REFERENCES

너무 많아 생략